Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_NFFP01000203 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_203_length_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000052 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_52_length_38761, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000210 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_210_length_378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000209 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_209_length_399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000114 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_114a_length_1118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000211 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_211_length_361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000101 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_101a_length_1893, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000032 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_32_length_79894, whole genome shotgun sequence 1 crisprs NA 0 2 0 0
NZ_NFFP01000144 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_144_length_895, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000080 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_80_length_4806, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000121 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_121a_length_969, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000006 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_6_length_242758, whole genome shotgun sequence 0 crisprs DEDDh,DinG 0 0 0 0
NZ_NFFP01000034 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_34_length_74282, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_NFFP01000200 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_200_length_459, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000207 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_207_length_439, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000077 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_77_length_5279, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000189 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_189b_length_447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000138 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_138_length_984, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000008 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_8_length_236384, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFP01000160 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_160_length_689, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000062 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_62_length_12564, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000030 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_30_length_91322, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000118 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_118_length_1209, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000164 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_164_length_648, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000059 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_59_length_28056, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000124 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_124_length_1160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000075 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_75_length_5475, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000108 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_108_length_1543, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000198 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_198b_length_320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000100 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_100_length_2340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000014 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_14_length_174017, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_NFFP01000021 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_21_length_136410, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000038 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_38_length_64861, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000128 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_128a_length_977, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000131 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_131_length_1066, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000137 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_137a_length_867, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000009 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_9_length_229125, whole genome shotgun sequence 0 crisprs DEDDh,PD-DExK 0 0 0 0
NZ_NFFP01000147 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_147_length_857, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000125 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_125_length_1160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000119 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_119_length_1193, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000072 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_72a_length_6799, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000183 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_183_length_523, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000133 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_133_length_1059, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000083 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_83_length_3686, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000102 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_102_length_1856, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000073 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_73_length_5860, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000161 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_161a_length_624, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000065 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_65_length_10441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000085 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_85_length_3570, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000151 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_151_length_802, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000145 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_145_length_894, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000206 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_206_length_440, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000057 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_57_length_29486, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000140 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_140_length_951, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000049 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_49_length_42604, whole genome shotgun sequence 0 crisprs NA 0 0 0 3
NZ_NFFP01000106 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_106_length_1677, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000158 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_158_length_699, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000056 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_56_length_30884, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000215 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_215_length_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000107 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_107_length_1652, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000180 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_180_length_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000091 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_91_length_3141, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000095 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_95_length_2597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000011 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_11_length_221992, whole genome shotgun sequence 0 crisprs WYL 0 0 1 0
NZ_NFFP01000117 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_117_length_1258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000169 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_169_length_627, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000037 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_37_length_65628, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000132 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_132_length_1064, whole genome shotgun sequence 0 crisprs NA 0 0 0 2
NZ_NFFP01000084 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_84_length_3622, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000173 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_173_length_585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000048 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_48_length_43969, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFP01000181 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_181_length_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000044 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_44_length_47188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000177 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_177_length_545, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000063 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_63_length_12412, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000050 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_50_length_41988, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000167 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_167_length_645, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000028 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_28_length_95256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000150 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_150_length_829, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000089 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_89_length_3469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000171 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_171_length_604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000165 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_165_length_647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000051 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_51_length_39301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000078 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_78_length_5271, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000025 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_25_length_101652, whole genome shotgun sequence 0 crisprs csa3 0 0 1 0
NZ_NFFP01000136 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_136_length_1032, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000071 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_71_length_6920, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000041 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_41_length_49858, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_NFFP01000096 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_96_length_2585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000094 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_94_length_2606, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000092 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_92_length_3139, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000047 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_47b_length_44162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000064 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_64_length_11541, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000055 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_55_length_36122, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFP01000142 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_142_length_931, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000195 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_195a_length_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000045 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_45_length_46940, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000058 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_58_length_28551, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000113 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_113_length_1364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000053 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_53b_length_37211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000172 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_172_length_588, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000179 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_179_length_539, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000036 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_36_length_68703, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000205 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_205_length_442, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000067 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_67_length_8585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000015 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_15_length_173435, whole genome shotgun sequence 0 crisprs csa3,DEDDh 0 0 2 0
NZ_NFFP01000004 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_4_length_279470, whole genome shotgun sequence 0 crisprs RT,csa3 0 0 1 0
NZ_NFFP01000046 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_46_length_45597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000208 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_208_length_430, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000115 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_115a_length_1043, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000079 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_79_length_5085, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000070 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_70_length_7230, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000214 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_214_length_340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000202 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_202_length_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000212 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_212_length_350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000182 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_182b_length_383, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000042 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_42_length_49288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000098 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_98_length_2361, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000031 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_31_length_84527, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000143 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_143_length_904, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000196 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_196_length_468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000074 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_74_length_5768, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000109 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_109_length_1468, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000116 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_116b_length_1047, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000184 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_184_length_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000146 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_146b_length_720, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000126 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_126_length_1151, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000129 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_129_length_1106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000040 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_40_length_54425, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000175 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_175_length_558, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000188 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_188_length_512, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000023 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_23_length_123220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000007 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_7_length_240951, whole genome shotgun sequence 0 crisprs TnsE_C 0 0 2 0
NZ_NFFP01000174 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_174a_length_483, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000191 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_191b_length_455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000153 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_153_length_748, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000190 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_190_length_499, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000170 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_170_length_604, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000026 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_26_length_100455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000068 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_68_length_7566, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000154 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_154a_length_615, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000176 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_176a_length_497, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000168 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_168_length_640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000086 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_86_length_3567, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000186 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_186_length_513, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000199 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_199_length_462, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000213 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_213_length_344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000099 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_99_length_2347, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000090 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_90_length_3397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000123 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_123_length_1160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000024 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_24_length_110726, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_NFFP01000017 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_17_length_160464, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000155 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_155_length_723, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000020 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_20_length_143454, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000139 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_139_length_967, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000135 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_135_length_1040, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000110 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_110_length_1402, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000005 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_5_length_252148, whole genome shotgun sequence 0 crisprs PD-DExK,csa3 0 0 0 0
NZ_NFFP01000081 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_81_length_4698, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000120 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_120_length_1183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000061 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_61_length_19366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000156 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_156b_length_640, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000194 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_194a_length_375, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000066 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_66_length_9253, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000016 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_16_length_172313, whole genome shotgun sequence 0 crisprs RT 0 0 0 0
NZ_NFFP01000152 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_152_length_794, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000060 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_60_length_24706, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000192 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_192_length_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000003 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_3_length_284817, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_NFFP01000122 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_122_length_1167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000105 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_105_length_1777, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000019 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_19_length_145281, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000149 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_149_length_835, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000157 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_157_length_716, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000103 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_103_length_1852, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000039 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_39_length_57471, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000022 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_22_length_126623, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000043 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_43_length_48762, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFP01000088 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_88_length_3516, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000141 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_141b_length_827, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000093 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_93_length_2834, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000033 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_33_length_76200, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000010 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_10_length_223772, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000012 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_12_length_185145, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000097 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_97_length_2365, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000204 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_204_length_444, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000082 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_82_length_4315, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000013 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_13_length_180362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000001 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_1_length_419081, whole genome shotgun sequence 1 crisprs DEDDh 0 0 0 0
NZ_NFFP01000127 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_127_length_1148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000027 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_27_length_96424, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_NFFP01000148 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_148_length_857, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000111 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_111_length_1399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000193 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_193_length_474, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000166 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_166_length_647, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000163 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_163_length_648, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000069 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_69_length_7543, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000002 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_2_length_295806, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 0
NZ_NFFP01000197 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_197a_length_398, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000185 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_185_length_514, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000178 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_178a_length_482, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000159 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_159_length_697, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000076 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_76_length_5307, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000054 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_54_length_36581, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000187 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_187_length_513, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000104 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_104_length_1836, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000130 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_130_length_1069, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000134 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_134_length_1053, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000162 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_162b_length_415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000087 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_87_length_3527, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_NFFP01000035 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_35_length_73990, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000201 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_201_length_446, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000112 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_112_length_1398, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_NFFP01000029 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_29_length_93437, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_NFFP01000018 Pseudomonas aeruginosa strain S708_C14_RS S708_C14_RS_NODE_18_length_155833, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_NFFP01000025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74299 : 80324 8 Pseudomonas_phage(33.33%) capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_NFFP01000097
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14 : 2349 6 Pseudomonas_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_NFFP01000087
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_NFFP01000087.1|WP_033975723.1|1982_2219_-|anti-CRISPR-protein-AcrF1 1982_2219_- 78 aa aa AcrIF1 NA NZ_NFFP01000087.1_1771_2011_- No NA
4. NZ_NFFP01000027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12722 : 52065 33 Planktothrix_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_NFFP01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 135445 : 141632 9 Vibrio_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_NFFP01000033
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66301 : 75915 14 Pseudomonas_phage(83.33%) integrase attL 66938:66953|attR 70022:70037
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_NFFP01000032
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFP01000032_1 54246-54445 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_NFFP01000032_1 1.1|54279|55|NZ_NFFP01000032|PILER-CR 54279-54333 55 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 168120-168174 0 1.0
NZ_NFFP01000032_1 1.1|54279|55|NZ_NFFP01000032|PILER-CR 54279-54333 55 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 116132-116186 0 1.0
NZ_NFFP01000032_1 1.1|54279|55|NZ_NFFP01000032|PILER-CR 54279-54333 55 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 90700-90754 1 0.982
NZ_NFFP01000032_1 1.2|54367|72|NZ_NFFP01000032|PILER-CR 54367-54438 72 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 168194-168265 12 0.833
NZ_NFFP01000032_1 1.2|54367|72|NZ_NFFP01000032|PILER-CR 54367-54438 72 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 116206-116277 12 0.833

1. spacer 1.1|54279|55|NZ_NFFP01000032|PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgctcgaccagtagccttcaaatggccccatatgctttcacctttgctcagga	CRISPR spacer
ggtgctcgaccagtagccttcaaatggccccatatgctttcacctttgctcagga	Protospacer
*******************************************************

2. spacer 1.1|54279|55|NZ_NFFP01000032|PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgctcgaccagtagccttcaaatggccccatatgctttcacctttgctcagga	CRISPR spacer
ggtgctcgaccagtagccttcaaatggccccatatgctttcacctttgctcagga	Protospacer
*******************************************************

3. spacer 1.1|54279|55|NZ_NFFP01000032|PILER-CR matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 1, identity: 0.982

ggtgctcgaccagtagccttcaaatggccccatatgctttcacctttgctcagga	CRISPR spacer
ggtgctcgaccggtagccttcaaatggccccatatgctttcacctttgctcagga	Protospacer
***********.*******************************************

4. spacer 1.2|54367|72|NZ_NFFP01000032|PILER-CR matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 12, identity: 0.833

tcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatagc	CRISPR spacer
tcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatagc	Protospacer
************************************************************

5. spacer 1.2|54367|72|NZ_NFFP01000032|PILER-CR matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 12, identity: 0.833

tcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatagc	CRISPR spacer
tcacgctccccacatccattcacctttcgccccacatccattcacctctcaccccatagc	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_NFFP01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71 : 48821 58 Pseudomonas_phage(56.52%) terminase,protease,integrase,tRNA,portal,capsid attL 6804:6820|attR 51334:51350
DBSCAN-SWA_2 90171 : 97842 10 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_NFFP01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21757 : 65403 59 Pseudomonas_phage(90.74%) terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_NFFP01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54507 : 91120 41 Pseudomonas_phage(91.3%) lysis,plate,protease,head,tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_NFFP01000040
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36832 : 43726 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_NFFP01000132
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_NFFP01000132.1|WP_016068584.1|319_622_-|anti-CRISPR-protein-AcrFgp36 319_622_- 100 aa aa AcrIF4 NA NZ_NFFP01000132.1_108_357_- No NA
NZ_NFFP01000132.1|WP_022580027.1|618_816_-|hypothetical-protein 618_816_- 65 aa aa AcrIE3 NA NA No NA
13. NZ_NFFP01000019
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 141588 : 145281 6 Pseudomonas_phage(83.33%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_NFFP01000001
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_NFFP01000001_1 99442-99536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_NFFP01000070
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 473 : 6862 7 unidentified_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_NFFP01000007
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27852 : 89854 54 uncultured_Mediterranean_phage(15.38%) tRNA,protease,transposase,integrase attL 56486:56503|attR 74644:74661
DBSCAN-SWA_2 189641 : 197595 7 Paenibacillus_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_NFFP01000049
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_NFFP01000049.1|WP_087937214.1|23585_23825_-|hypothetical-protein 23585_23825_- 79 aa aa AcrIE6 NA NZ_NFFP01000049.1_23376_23589_- No NA
NZ_NFFP01000049.1|WP_087937215.1|23826_24147_-|hypothetical-protein 23826_24147_- 106 aa aa AcrIE7 NA NZ_NFFP01000049.1_23376_23589_- No NA
NZ_NFFP01000049.1|WP_087937216.1|24171_24408_-|anti-CRISPR-protein-AcrF1 24171_24408_- 78 aa aa AcrIF1 NA NZ_NFFP01000049.1_23376_23589_- No NA
18. NZ_NFFP01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 313 : 36876 43 uncultured_Caudovirales_phage(25.0%) plate,tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_NFFP01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 182508 : 191537 8 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_NFFP01000021
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 49970 51 Salmonella_phage(10.0%) coat,tRNA,transposase,integrase attL 14984:14998|attR 34598:34612
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage