Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
NZ_QEJI01000004 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_5, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000008 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_9, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000147 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_151, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000165 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_169, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000089 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_90, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000166 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_170, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000184 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_191, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000171 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_175, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000198 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_205, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000101 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_102, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000106 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_107, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000134 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_136, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000177 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_181, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000115 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_116, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000064 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_65, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000014 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_15, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000040 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_41, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000196 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_203, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000204 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_212, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000191 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_198, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000199 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_206, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000151 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_155, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000183 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_190, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000098 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_99, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000077 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_78, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000156 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_160, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000003 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_4, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000137 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_139, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000203 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_211, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000124 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_125, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000069 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_70, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000113 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_114, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000123 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_124, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000125 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_126, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000088 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_89, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000024 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_25, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000086 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_87, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000015 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_16, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
NZ_QEJI01000038 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_39, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000056 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_57, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000160 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_164, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000025 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_26, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000022 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_23, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000058 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_59, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000009 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_10, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000152 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_156, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000092 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_93, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000109 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_110, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000121 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_122, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000061 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_62, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000020 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_21, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000043 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_44, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000051 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_52, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000050 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_51, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000039 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_40, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000011 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_12, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
NZ_QEJI01000127 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_128, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000026 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_27, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000157 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_161, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000096 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_97, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000182 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_189, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000143 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_147, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000035 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_36, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000193 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_200, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000153 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_157, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000144 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_148, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000164 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_168, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000070 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_71, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000031 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_32, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000114 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_115, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000111 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_112, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000180 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_186, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000094 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_95, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000045 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_46, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000074 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_75, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000041 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_42, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000080 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_81, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000117 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_118, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000154 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_158, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000136 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_138, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000037 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_38, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000002 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_3, whole genome shotgun sequence | 1 crisprs | 1 | 8 | 0 | 0 | |
NZ_QEJI01000159 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_163, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000197 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_204, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000072 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_73, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000036 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_37, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000107 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_108, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000110 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_111, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000192 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_199, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000178 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_183, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000016 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_17, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000076 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_77, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000176 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_180, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000027 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_28, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000130 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_131, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000104 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_105, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000049 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_50, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000019 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_20, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000018 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_19, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000097 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_98, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000053 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_54, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000105 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_106, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000140 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_144, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000102 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_103, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000129 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_130, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000012 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_13, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000116 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_117, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000179 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_184, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000044 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_45, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000075 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_76, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000148 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_152, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000091 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_92, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000195 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_202, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000079 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_80, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000093 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_94, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000131 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_132, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000170 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_174, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000163 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_167, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000087 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_88, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000158 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_162, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000029 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_30, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000062 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_63, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000071 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_72, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000055 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_56, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000139 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_142, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000081 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_82, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000169 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_173, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000162 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_166, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000120 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_121, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000135 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_137, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000033 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_34, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000032 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_33, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000042 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_43, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000060 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_61, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000202 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_209, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000142 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_146, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000201 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_208, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000030 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_31, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000010 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_11, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000155 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_159, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000065 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_66, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000021 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_22, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000133 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_135, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000023 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_24, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
NZ_QEJI01000189 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_196, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000173 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_177, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000063 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_64, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000161 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_165, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000186 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_193, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000194 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_201, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000073 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_74, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000185 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_192, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000085 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_86, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000132 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_134, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000138 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_141, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000005 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_6, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000017 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_18, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000146 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_150, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000006 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_7, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000167 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_171, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000090 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_91, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000118 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_119, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000054 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_55, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000112 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_113, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000100 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_101, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000099 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_100, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000048 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_49, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000028 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_29, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000067 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_68, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000188 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_195, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000084 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_85, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000187 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_194, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000068 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_69, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000128 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_129, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000066 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_67, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000175 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_179, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000200 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_207, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000122 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_123, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000172 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_176, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000078 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_79, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000149 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_153, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000034 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_35, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000046 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_47, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000150 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_154, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000126 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_127, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000001 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_2, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000059 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_60, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000095 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_96, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000103 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_104, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000007 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_8, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 2 | |
NZ_QEJI01000052 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_53, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000141 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_145, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000119 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_120, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000181 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_187, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000083 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_84, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000082 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_83, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000168 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_172, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000190 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_197, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000047 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_48, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000145 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_149, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000057 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_58, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000174 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_178, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000013 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_14, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
NZ_QEJI01000108 | Staphylococcus pseudintermedius strain ST547 1 K40_S38_L001_R2_001-1_contig_109, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 78234 : 92289 | 10 | uncultured_Mediterranean_phage(33.33%) | NA |
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
NZ_QEJI01000002_1 | 157989-158748 |
NA
|
11 spacers
|
cas2,cas1,cas9 |
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
NZ_QEJI01000002_1 | 158287-158316 | 30 | NZ_QEJI01000007.1 | 157960-157989 | 0 | 1.0 |
ggaaaatgtggtaatgaaggaggattttga CRISPR spacer ggaaaatgtggtaatgaaggaggattttga Protospacer ******************************
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
NZ_QEJI01000002_1 | 158287-158316 | 30 | MK075005 | Staphylococcus phage phiSP119-2, partial genome | 22211-22240 | 0 | 1.0 | |
NZ_QEJI01000002_1 | 158419-158449 | 31 | AP019561 | Staphylococcus phage SP197 DNA, complete genome | 4387-4417 | 2 | 0.935 | |
NZ_QEJI01000002_1 | 158419-158449 | 31 | MK075006 | Staphylococcus phage phiSP119-3, complete genome | 16262-16292 | 2 | 0.935 | |
NZ_QEJI01000002_1 | 158419-158449 | 31 | MK075004 | Staphylococcus phage phiSP119-1, complete genome | 16026-16056 | 2 | 0.935 | |
NZ_QEJI01000002_1 | 158683-158712 | 30 | NZ_CP031260 | Klebsiella quasipneumoniae strain L22 plasmid pL22-3, complete sequence | 48568-48597 | 3 | 0.9 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | KX827371 | Staphylococcus phage SpT99F3, complete genome | 14235-14264 | 4 | 0.867 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MT423824 | Staphylococcus virus pSp_SNUABM-S, complete genome | 21270-21299 | 4 | 0.867 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MT423823 | Staphylococcus virus pSp_SNUABM-J, complete genome | 22012-22041 | 4 | 0.867 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | KX827369 | Staphylococcus phage SpT152, complete genome | 14568-14597 | 4 | 0.867 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP053959 | Staphylococcus capitis strain FDAARGOS_753 plasmid unnamed2, complete sequence | 674-703 | 5 | 0.833 | |
NZ_QEJI01000002_1 | 158025-158053 | 29 | MN693449 | Marine virus AFVG_25M25, complete genome | 24654-24682 | 6 | 0.793 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP015175 | Staphylococcus aureus strain RIVM6519 plasmid pRIVM6519-2, complete sequence | 1335-1364 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP033113 | Staphylococcus aureus strain ST20130944 plasmid pST20130944, complete sequence | 166-195 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_005054 | Staphylococcus aureus plasmid pLW043, complete sequence | 19260-19289 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_015173 | Staphylococcus simulans bv. staphylolyticus strain NRRL B-2628 plasmid pACK2, complete sequence | 28186-28215 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_005208 | Staphylococcus warneri plasmid pPI-2 DNA, complete sequence | 1593-1622 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | CP030614 | Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence | 6622-6651 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP033115 | Staphylococcus aureus strain ST20130945 plasmid pST20130945, complete sequence | 165-194 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_012547 | Staphylococcus aureus plasmid pGO1, complete sequence | 38327-38356 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_005024 | Staphylococcus aureus plasmid pSK41, complete sequence | 38327-38356 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_013342 | Staphylococcus aureus plasmid SAP079A, complete sequence | 43204-43233 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_013344 | Staphylococcus aureus plasmid SAP082A, complete sequence | 43754-43783 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_025022 | Staphylococcus aureus subsp. aureus strain SM52 plasmid pSM52, complete sequence | 383-412 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP047823 | Staphylococcus aureus strain UP_1278 plasmid unnamed1, complete sequence | 2819-2848 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_007165 | Staphylococcus warneri plasmid pSW174, complete sequence | 1400-1429 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_007166 | Staphylococcus warneri plasmid pSW49, complete sequence | 1400-1429 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_AP017321 | Staphylococcus aureus strain MI plasmid pMI, complete sequence | 53366-53395 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | AP012550 | Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G | 35001-35030 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP026963 | Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 | 41659-41688 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NC_013372 | Staphylococcus epidermidis plasmid SAP016A, complete sequence | 41178-41207 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP029170 | Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence | 178-207 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP029171 | Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2d, complete sequence | 178-207 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_CP040620 | Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence | 6985-7014 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158090-158119 | 30 | NZ_MH587578 | Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence | 21771-21800 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158222-158250 | 29 | KY744231 | Sulfolobus islandicus rod-shaped virus 4, partial genome | 4219-4247 | 6 | 0.793 | |
NZ_QEJI01000002_1 | 158287-158316 | 30 | MG592459 | Vibrio phage 1.084.O._10N.261.49.F5, partial genome | 73193-73222 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MF288922 | Bacillus phage Janet, complete genome | 141749-141778 | 6 | 0.8 | |
NZ_QEJI01000002_1 | 158222-158250 | 29 | MK448891 | Streptococcus phage Javan266, complete genome | 33103-33131 | 7 | 0.759 | |
NZ_QEJI01000002_1 | 158419-158449 | 31 | AB797215 | Klebsiella phage 0507-KN2-1 DNA, complete genome | 97134-97164 | 7 | 0.774 | |
NZ_QEJI01000002_1 | 158419-158449 | 31 | MG428990 | Klebsiella phage Menlow, complete genome | 31711-31741 | 7 | 0.774 | |
NZ_QEJI01000002_1 | 158551-158580 | 30 | NZ_CP026317 | Vibrio campbellii strain BoB-90 plasmid unnamed 1, complete sequence | 38085-38114 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN693991 | Marine virus AFVG_250M861, complete genome | 31401-31430 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN692996 | Marine virus AFVG_117M70, complete genome | 31389-31418 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN694291 | Marine virus AFVG_250M864, complete genome | 6916-6945 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN694613 | Marine virus AFVG_250M1003, complete genome | 33736-33765 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN694083 | Marine virus AFVG_250M863, complete genome | 6920-6949 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN693818 | Marine virus AFVG_250M1205, complete genome | 32048-32077 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN694793 | Marine virus AFVG_250M862, complete genome | 31400-31429 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158617-158646 | 30 | MN693817 | Marine virus AFVG_250M336, complete genome | 32026-32055 | 7 | 0.767 | |
NZ_QEJI01000002_1 | 158222-158250 | 29 | NC_008376 | Geobacillus phage GBSV1, complete genome | 6649-6677 | 8 | 0.724 | |
NZ_QEJI01000002_1 | 158222-158250 | 29 | NC_009737 | Bacillus virus 1, complete genome | 6646-6674 | 8 | 0.724 |
ggaaaatgtggtaatgaaggaggattttga CRISPR spacer ggaaaatgtggtaatgaaggaggattttga Protospacer ******************************
cgtcgatttcgacataatcaatcgccttatg CRISPR spacer cgtcgatttcgacataatcaatcgctttgtg Protospacer *************************.**.**
cgtcgatttcgacataatcaatcgccttatg CRISPR spacer cgtcgatttcgacataatcaatcgctttgtg Protospacer *************************.**.**
cgtcgatttcgacataatcaatcgccttatg CRISPR spacer cgtcgatttcgacataatcaatcgctttgtg Protospacer *************************.**.**
cgaaagtaaagatagtatgcaaggtgcaag CRISPR spacer tgaaagtaaagatagtatgaaaggcgcaag Protospacer .****************** ****.*****
tttccttcgtgatttcttcttctacttcga CRISPR spacer ttctctccgtgatttcttcttctgcttcga Protospacer **..**.****************.******
tttccttcgtgatttcttcttctacttcga CRISPR spacer ttctctccgtgatttcttcttctgcttcga Protospacer **..**.****************.******
tttccttcgtgatttcttcttctacttcga CRISPR spacer ttctctccgtgatttcttcttctgcttcga Protospacer **..**.****************.******
tttccttcgtgatttcttcttctacttcga CRISPR spacer ttctctccgtgatttcttcttctgcttcga Protospacer **..**.****************.******
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgcg Protospacer **.*..*****.**************.***
attagaaatgttagtccctaagttacaga CRISPR spacer attagtaatgttagttcctaagtaatgta Protospacer ***** *********.******* *.. *
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgtttttgtcctgtatgtgct Protospacer **.*..***** **************.**
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
-tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer atgta-aaatcgattttgtcctgtatgtgca Protospacer **.* .*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtctgcgct Protospacer **.*..*****.*********** *****
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtctgcgct Protospacer **.*..*****.*********** *****
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtctgcgct Protospacer **.*..*****.*********** *****
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtctgcgct Protospacer **.*..*****.*********** *****
tgcaggaatcggttttgtcctgtatgcgcg CRISPR spacer tgtaaaaatcgattttgtcctgtatgtgca Protospacer **.*..*****.**************.**.
cattaactgctttgtcaaactcactaatt CRISPR spacer catttactgctttctcaaactcaaatttt Protospacer **** ******** ********* **
ggaaaatgtggtaatgaaggaggattttga CRISPR spacer ggttcaggtggtgatggaggaggattttga Protospacer ** * *****.***.*************
tttccttcgtgatttcttcttctacttcga CRISPR spacer ttatcttagtgatttcttcttctagttcac Protospacer ** .*** **************** ***.
cattaactgctttgtcaaactcactaatt CRISPR spacer gtttaactgccttgtcaatctcactgaca Protospacer ********.******* ******.*.
cgtcgatttcgacataatcaatcgccttatg CRISPR spacer cgtcgatttcgaaattatcaatcggaacctg Protospacer ************ ** ******** . **
cgtcgatttcgacataatcaatcgccttatg CRISPR spacer cgtcgatttcgaaattatcaatcggaacctg Protospacer ************ ** ******** . **
tgagcctttatcatttagaacagctagagt CRISPR spacer tttaactttatcatttataacagcttgagc Protospacer * . ************ ******* ***.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer attttttcttgatttcttcttcttcttctt Protospacer **..*** ************** ****
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
tttccttcgtgatttcttcttctacttcga CRISPR spacer cctcttcagtgatttcttcttcgacttcgg Protospacer ..**.*. ************** ******.
cattaactgctttgtcaaactcactaatt CRISPR spacer gattaactgctttttcaaattcacaggag Protospacer ************ *****.**** ..
cattaactgctttgtcaaactcactaatt CRISPR spacer gattaactgctttttcaaattcacaggag Protospacer ************ *****.**** ..
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 62570 : 70990 | 9 | Synechococcus_phage(33.33%) | NA |
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 10688 : 32071 | 24 | Staphylococcus_phage(95.0%) | NA | ||
DBSCAN-SWA_2 | 36189 : 43980 | 6 | Staphylococcus_phage(100.0%) | NA |
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|---|---|---|---|---|---|
DBSCAN-SWA_1 | 139056 : 178618 | 57 | Staphylococcus_phage(73.33%) | NA |