Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FERW01000067 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000027 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000066 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FERW01000057 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000063 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000045 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000050 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000010 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FERW01000022 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000061 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000033 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs c2c4_V-U1 0 0 0 0
NZ_FERW01000035 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000024 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FERW01000025 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FERW01000007 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs cas3 1 0 0 0
NZ_FERW01000068 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000002 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000070 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000072 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000052 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000008 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 1 1 0 0
NZ_FERW01000051 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000065 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000043 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000038 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000031 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 2 crisprs NA 2 0 0 0
NZ_FERW01000032 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000054 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000013 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FERW01000041 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000005 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_FERW01000016 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FERW01000055 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000021 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000023 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000001 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FERW01000015 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000020 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000026 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000056 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000044 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000042 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000004 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 2 0
NZ_FERW01000060 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000014 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_FERW01000059 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000036 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FERW01000019 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000030 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000048 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000003 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000011 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000046 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000047 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000064 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000039 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000049 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000017 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FERW01000034 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000009 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000029 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000018 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000071 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000028 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 1 crisprs NA 1 0 0 0
NZ_FERW01000012 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_FERW01000069 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000058 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000040 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000053 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000037 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000062 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FERW01000006 Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_FERW01000011
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FERW01000066
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000066_1 598-700 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000066_1 1.1|625|49|NZ_FERW01000066|CRISPRCasFinder 625-673 49 NZ_FERW01000010.1 44823-44871 1 0.98

1. spacer 1.1|625|49|NZ_FERW01000066|CRISPRCasFinder matches to position: 44823-44871, mismatch: 1, identity: 0.98

ggcttgtacggtttcggttttttttttgaggtttcgggcaacttctaaa	CRISPR spacer
ggcttgttcggtttcggttttttttttgaggtttcgggcaacttctaaa	Protospacer
******* *****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FERW01000050
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FERW01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4200 : 16011 13 Haemophilus_phage(46.15%) plate,terminase,head NA
DBSCAN-SWA_2 69905 : 77881 11 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FERW01000031
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000031_1 1090-1192 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000031_2 1288-1468 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000031_1 1.1|1115|52|NZ_FERW01000031|CRISPRCasFinder 1115-1166 52 NZ_FERW01000050.1 321-372 2 0.962
NZ_FERW01000031_2 2.2|1394|50|NZ_FERW01000031|CRISPRCasFinder 1394-1443 50 NZ_FERW01000009.1 5630-5679 1 0.98
NZ_FERW01000031_2 2.2|1394|50|NZ_FERW01000031|CRISPRCasFinder 1394-1443 50 NZ_FERW01000009.1 5907-5956 1 0.98

1. spacer 1.1|1115|52|NZ_FERW01000031|CRISPRCasFinder matches to position: 321-372, mismatch: 2, identity: 0.962

acccccaacgcggcaggaatctatcggaaataaccgaaaccggacgaaccta	CRISPR spacer
accaccaacgcggcaggaatctatcggaaataaccgaaaccagacgaaccta	Protospacer
*** *************************************.**********

2. spacer 2.2|1394|50|NZ_FERW01000031|CRISPRCasFinder matches to position: 5630-5679, mismatch: 1, identity: 0.98

atgaaaagattgttgtcgcttcggataaatttttaccgtgttgggttcta	CRISPR spacer
atgaaaagattgttgtcgcttcggataaatttttgccgtgttgggttcta	Protospacer
**********************************.***************

3. spacer 2.2|1394|50|NZ_FERW01000031|CRISPRCasFinder matches to position: 5907-5956, mismatch: 1, identity: 0.98

atgaaaagattgttgtcgcttcggataaatttttaccgtgttgggttcta	CRISPR spacer
atgaaaagattgttgtcgcttcggataaatttttgccgtgttgggttcta	Protospacer
**********************************.***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FERW01000022
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FERW01000028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000028_1 27110-27287 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000007.1 2027-2070 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000008.1 59662-59705 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000008.1 64436-64479 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000009.1 29-72 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000009.1 654-697 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000011.1 940-983 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000017.1 1036-1079 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000022.1 858-901 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000032.1 19307-19350 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000037.1 13483-13526 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000037.1 14467-14510 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000040.1 8687-8730 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000040.1 8833-8876 1 0.977
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000043.1 6769-6812 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000043.1 7113-7156 0 1.0
NZ_FERW01000028_1 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder 27214-27257 44 NZ_FERW01000043.1 7608-7651 1 0.977

1. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 2027-2070, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

2. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 59662-59705, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

3. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 64436-64479, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

4. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 29-72, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaacttta	Protospacer
*****************************************.**

5. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 654-697, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaacttta	Protospacer
*****************************************.**

6. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 940-983, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agttcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
*** ****************************************

7. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 1036-1079, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

8. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 858-901, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

9. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 19307-19350, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaacttta	Protospacer
*****************************************.**

10. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 13483-13526, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

11. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 14467-14510, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

12. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 8687-8730, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttaagtttcagctatttagaataaattttgaaactcta	Protospacer
********.***********************************

13. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 8833-8876, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttaagtttcagctatttagaataaattttgaaactcta	Protospacer
********.***********************************

14. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 6769-6812, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

15. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 7113-7156, mismatch: 0, identity: 1.0

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agtgcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
********************************************

16. spacer 1.2|27214|44|NZ_FERW01000028|CRISPRCasFinder matches to position: 7608-7651, mismatch: 1, identity: 0.977

agtgcgttgagtttcagctatttagaataaattttgaaactcta	CRISPR spacer
agttcgttgagtttcagctatttagaataaattttgaaactcta	Protospacer
*** ****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FERW01000024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6677 8 Acinetobacter_phage(16.67%) integrase,transposase attL 2596:2609|attR 9657:9670
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FERW01000025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000025_1 6018-6123 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FERW01000007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000007_1 43230-43401 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000007_1 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder 43326-43375 50 NZ_FERW01000007.1 43850-43899 0 1.0
NZ_FERW01000007_1 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder 43326-43375 50 NZ_FERW01000011.1 78961-79010 0 1.0
NZ_FERW01000007_1 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder 43326-43375 50 NZ_FERW01000029.1 24336-24385 0 1.0
NZ_FERW01000007_1 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder 43326-43375 50 NZ_FERW01000029.1 23909-23958 1 0.98
NZ_FERW01000007_1 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder 43326-43375 50 NZ_FERW01000030.1 39-88 0 1.0

1. spacer 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder matches to position: 43850-43899, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

2. spacer 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder matches to position: 78961-79010, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

3. spacer 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder matches to position: 24336-24385, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

4. spacer 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder matches to position: 23909-23958, mismatch: 1, identity: 0.98

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacctttccg	Protospacer
********************************************.*****

5. spacer 1.2|43326|50|NZ_FERW01000007|CRISPRCasFinder matches to position: 39-88, mismatch: 0, identity: 1.0

tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	CRISPR spacer
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg	Protospacer
**************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FERW01000002
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FERW01000030
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_FERW01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 127469 : 136680 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
14. NZ_FERW01000017
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
15. NZ_FERW01000008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000008_1 60644-60745 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000008_1 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder 60678-60711 34 NZ_FERW01000007.1 2181-2214 1 0.971
NZ_FERW01000008_1 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder 60678-60711 34 NZ_FERW01000008.1 64765-64798 2 0.941

1. spacer 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder matches to position: 2181-2214, mismatch: 1, identity: 0.971

gtcttttataaactttgaatattgctgttatccc	CRISPR spacer
gtcttttataatctttgaatattgctgttatccc	Protospacer
*********** **********************

2. spacer 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder matches to position: 64765-64798, mismatch: 2, identity: 0.941

gtcttttataaactttgaatattgctgttatccc	CRISPR spacer
gtcttttataacctttgaatattgccgttatccc	Protospacer
*********** *************.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FERW01000008_1 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder 60678-60711 34 NZ_LR699116 Aquicella lusitana strain SGT-39 plasmid 3 2708-2741 11 0.676

1. spacer 1.1|60678|34|NZ_FERW01000008|CRISPRCasFinder matches to NZ_LR699116 (Aquicella lusitana strain SGT-39 plasmid 3) position: , mismatch: 11, identity: 0.676

gtcttttataaactttgaatattgctgttatccc	CRISPR spacer
tccttttataaaatttgaatatttctaactttgg	Protospacer
 .********** ********** **. . *.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
16. NZ_FERW01000009
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
17. NZ_FERW01000029
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
18. NZ_FERW01000043
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
19. NZ_FERW01000010
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000010_1 73524-73630 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
20. NZ_FERW01000032
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
21. NZ_FERW01000040
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
22. NZ_FERW01000005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17553 : 27546 17 Vibrio_phage(25.0%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FERW01000005.1|WP_042743676.1|56272_56623_-|anti-CRISPR-protein-AcrIIC3 56272_56623_- 116 aa aa AcrIIC3 NA NZ_FERW01000005.1_55653_55863_- No NA
NZ_FERW01000005.1|WP_042743678.1|55855_56227_-|anti-CRISPR-protein-AcrIIC2 55855_56227_- 123 aa aa NA NA NZ_FERW01000005.1_55653_55863_- No NA
23. NZ_FERW01000037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
24. NZ_FERW01000016
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FERW01000016_1 39324-39407 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FERW01000016_1 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder 39353-39378 26 NZ_FERW01000002.1 38786-38811 0 1.0
NZ_FERW01000016_1 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder 39353-39378 26 NZ_FERW01000002.1 38264-38289 1 0.962
NZ_FERW01000016_1 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder 39353-39378 26 NZ_FERW01000022.1 18757-18782 0 1.0
NZ_FERW01000016_1 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder 39353-39378 26 NZ_FERW01000022.1 19242-19267 0 1.0
NZ_FERW01000016_1 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder 39353-39378 26 NZ_FERW01000022.1 18296-18321 1 0.962

1. spacer 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder matches to position: 38786-38811, mismatch: 0, identity: 1.0

gacgcagggttaagaaaacctacatc	CRISPR spacer
gacgcagggttaagaaaacctacatc	Protospacer
**************************

2. spacer 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder matches to position: 38264-38289, mismatch: 1, identity: 0.962

gacgcagggttaagaaaacctacatc	CRISPR spacer
gacgcagggttaagaaaacctgcatc	Protospacer
*********************.****

3. spacer 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder matches to position: 18757-18782, mismatch: 0, identity: 1.0

gacgcagggttaagaaaacctacatc	CRISPR spacer
gacgcagggttaagaaaacctacatc	Protospacer
**************************

4. spacer 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder matches to position: 19242-19267, mismatch: 0, identity: 1.0

gacgcagggttaagaaaacctacatc	CRISPR spacer
gacgcagggttaagaaaacctacatc	Protospacer
**************************

5. spacer 1.1|39353|26|NZ_FERW01000016|CRISPRCasFinder matches to position: 18296-18321, mismatch: 1, identity: 0.962

gacgcagggttaagaaaacctacatc	CRISPR spacer
gacgcaaggttaagaaaacctacatc	Protospacer
******.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage