| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000067 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000027 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000066 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FERW01000057 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000063 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000045 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000050 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000010 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000022 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000061 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000033 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000035 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000024 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FERW01000025 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000007 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FERW01000068 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000002 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000070 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000072 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000052 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000008 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 1 | 1 | 0 | 0 | |
| NZ_FERW01000051 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000065 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000043 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000038 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000031 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 2 crisprs | 2 | 0 | 0 | 0 | |
| NZ_FERW01000032 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000054 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000013 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000041 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000005 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 2 | |
| NZ_FERW01000016 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FERW01000055 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000021 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000023 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000001 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 1 | 0 | |
| NZ_FERW01000015 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000020 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000026 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000056 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000044 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000042 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000004 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 2 | 0 | |
| NZ_FERW01000060 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000014 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000059 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000036 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000019 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000030 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000048 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000003 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000011 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000046 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000047 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000064 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000039 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000049 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000017 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000034 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000009 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000029 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000018 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000071 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000028 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 1 crisprs | 1 | 0 | 0 | 0 | |
| NZ_FERW01000012 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000069 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000058 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000040 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000053 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000037 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000062 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| NZ_FERW01000006 | Neisseria meningitidis strain 2842STDY5881035, whole genome shotgun sequence | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000066_1 | 625-673 | 49 | NZ_FERW01000010.1 | 44823-44871 | 1 | 0.98 |
ggcttgtacggtttcggttttttttttgaggtttcgggcaacttctaaa CRISPR spacer ggcttgttcggtttcggttttttttttgaggtttcgggcaacttctaaa Protospacer ******* *****************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 4200 : 16011 | 13 | Haemophilus_phage(46.15%) | NA | ||
| DBSCAN-SWA_2 | 69905 : 77881 | 11 | Staphylococcus_phage(50.0%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FERW01000031_1 | 1090-1192 | Orphan |
I-E
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| NZ_FERW01000031_2 | 1288-1468 | Orphan |
I-E
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000031_1 | 1115-1166 | 52 | NZ_FERW01000050.1 | 321-372 | 2 | 0.962 | |
| NZ_FERW01000031_2 | 1394-1443 | 50 | NZ_FERW01000009.1 | 5630-5679 | 1 | 0.98 | |
| NZ_FERW01000031_2 | 1394-1443 | 50 | NZ_FERW01000009.1 | 5907-5956 | 1 | 0.98 |
acccccaacgcggcaggaatctatcggaaataaccgaaaccggacgaaccta CRISPR spacer accaccaacgcggcaggaatctatcggaaataaccgaaaccagacgaaccta Protospacer *** *************************************.**********
atgaaaagattgttgtcgcttcggataaatttttaccgtgttgggttcta CRISPR spacer atgaaaagattgttgtcgcttcggataaatttttgccgtgttgggttcta Protospacer **********************************.***************
atgaaaagattgttgtcgcttcggataaatttttaccgtgttgggttcta CRISPR spacer atgaaaagattgttgtcgcttcggataaatttttgccgtgttgggttcta Protospacer **********************************.***************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000007.1 | 2027-2070 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000008.1 | 59662-59705 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000008.1 | 64436-64479 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000009.1 | 29-72 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000009.1 | 654-697 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000011.1 | 940-983 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000017.1 | 1036-1079 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000022.1 | 858-901 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000032.1 | 19307-19350 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000037.1 | 13483-13526 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000037.1 | 14467-14510 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000040.1 | 8687-8730 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000040.1 | 8833-8876 | 1 | 0.977 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000043.1 | 6769-6812 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000043.1 | 7113-7156 | 0 | 1.0 | |
| NZ_FERW01000028_1 | 27214-27257 | 44 | NZ_FERW01000043.1 | 7608-7651 | 1 | 0.977 |
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaacttta Protospacer *****************************************.**
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaacttta Protospacer *****************************************.**
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agttcgttgagtttcagctatttagaataaattttgaaactcta Protospacer *** ****************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaacttta Protospacer *****************************************.**
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttaagtttcagctatttagaataaattttgaaactcta Protospacer ********.***********************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttaagtttcagctatttagaataaattttgaaactcta Protospacer ********.***********************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agtgcgttgagtttcagctatttagaataaattttgaaactcta Protospacer ********************************************
agtgcgttgagtttcagctatttagaataaattttgaaactcta CRISPR spacer agttcgttgagtttcagctatttagaataaattttgaaactcta Protospacer *** ****************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 0 : 6677 | 8 | Acinetobacter_phage(16.67%) | attL 2596:2609|attR 9657:9670 |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000007_1 | 43326-43375 | 50 | NZ_FERW01000007.1 | 43850-43899 | 0 | 1.0 | |
| NZ_FERW01000007_1 | 43326-43375 | 50 | NZ_FERW01000011.1 | 78961-79010 | 0 | 1.0 | |
| NZ_FERW01000007_1 | 43326-43375 | 50 | NZ_FERW01000029.1 | 24336-24385 | 0 | 1.0 | |
| NZ_FERW01000007_1 | 43326-43375 | 50 | NZ_FERW01000029.1 | 23909-23958 | 1 | 0.98 | |
| NZ_FERW01000007_1 | 43326-43375 | 50 | NZ_FERW01000030.1 | 39-88 | 0 | 1.0 |
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacctttccg Protospacer ********************************************.*****
tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg CRISPR spacer tagaatttcaatgcctcaagaatttatcggaaaaaaccaaaacccttccg Protospacer **************************************************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 127469 : 136680 | 9 | Burkholderia_phage(28.57%) | NA |
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000008_1 | 60678-60711 | 34 | NZ_FERW01000007.1 | 2181-2214 | 1 | 0.971 | |
| NZ_FERW01000008_1 | 60678-60711 | 34 | NZ_FERW01000008.1 | 64765-64798 | 2 | 0.941 |
gtcttttataaactttgaatattgctgttatccc CRISPR spacer gtcttttataatctttgaatattgctgttatccc Protospacer *********** **********************
gtcttttataaactttgaatattgctgttatccc CRISPR spacer gtcttttataacctttgaatattgccgttatccc Protospacer *********** *************.********
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| NZ_FERW01000008_1 | 60678-60711 | 34 | NZ_LR699116 | Aquicella lusitana strain SGT-39 plasmid 3 | 2708-2741 | 11 | 0.676 |
gtcttttataaactttgaatattgctgttatccc CRISPR spacer tccttttataaaatttgaatatttctaactttgg Protospacer .********** ********** **. . *.
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|---|---|---|---|---|---|
| DBSCAN-SWA_1 | 17553 : 27546 | 17 | Vibrio_phage(25.0%) | NA |
| Acr ID | Acr position | Acr size | |||
|---|---|---|---|---|---|
| 116 aa aa | AcrIIC3 | NA | NZ_FERW01000005.1_55653_55863_- | No | NA |
| 123 aa aa | NA | NA | NZ_FERW01000005.1_55653_55863_- | No | NA |
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|
| NZ_FERW01000016_1 | 39353-39378 | 26 | NZ_FERW01000002.1 | 38786-38811 | 0 | 1.0 | |
| NZ_FERW01000016_1 | 39353-39378 | 26 | NZ_FERW01000002.1 | 38264-38289 | 1 | 0.962 | |
| NZ_FERW01000016_1 | 39353-39378 | 26 | NZ_FERW01000022.1 | 18757-18782 | 0 | 1.0 | |
| NZ_FERW01000016_1 | 39353-39378 | 26 | NZ_FERW01000022.1 | 19242-19267 | 0 | 1.0 | |
| NZ_FERW01000016_1 | 39353-39378 | 26 | NZ_FERW01000022.1 | 18296-18321 | 1 | 0.962 |
gacgcagggttaagaaaacctacatc CRISPR spacer gacgcagggttaagaaaacctacatc Protospacer **************************
gacgcagggttaagaaaacctacatc CRISPR spacer gacgcagggttaagaaaacctgcatc Protospacer *********************.****
gacgcagggttaagaaaacctacatc CRISPR spacer gacgcagggttaagaaaacctacatc Protospacer **************************
gacgcagggttaagaaaacctacatc CRISPR spacer gacgcagggttaagaaaacctacatc Protospacer **************************
gacgcagggttaagaaaacctacatc CRISPR spacer gacgcaaggttaagaaaacctacatc Protospacer ******.*******************
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|