Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_FZZH01000089 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000153 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000158 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000084 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000201 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000195 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000210 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000228 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000193 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000085 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000148 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000056 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000009 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000068 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000094 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000015 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000160 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000080 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000198 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000167 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000001 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_FZZH01000030 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000073 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000224 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000018 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000006 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000104 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000129 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000185 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000187 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000229 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000002 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000136 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000076 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000208 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000042 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000166 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000100 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000049 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000037 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000143 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000061 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000180 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000097 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000020 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000101 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000171 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000038 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000145 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000052 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000122 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000174 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000189 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000012 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000149 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000102 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000202 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000211 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000144 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000169 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000118 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000011 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000115 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000090 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000051 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000054 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000017 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000207 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000008 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000192 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000131 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000028 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000156 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000077 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000034 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000165 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000025 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000120 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000093 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000083 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000053 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000130 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000221 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000069 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000142 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000222 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000168 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000186 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000027 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000092 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FZZH01000108 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000146 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000087 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000041 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000157 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000127 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000213 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000140 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000105 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000182 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000004 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000062 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FZZH01000113 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000032 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FZZH01000134 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000227 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000088 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000003 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 1 2
NZ_FZZH01000154 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000103 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000172 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000123 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000024 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000138 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000214 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000199 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000209 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000110 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000050 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000070 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000225 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000147 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000091 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000116 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000155 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000055 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FZZH01000188 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000137 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000036 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000107 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000220 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000074 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000010 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000065 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000197 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000215 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000039 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000045 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000159 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000046 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000014 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000226 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000181 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000183 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000047 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000072 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000086 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000206 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000064 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000191 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000219 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000121 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000128 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000173 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000016 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000081 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000176 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000175 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000117 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000057 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000133 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000079 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000164 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000033 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs cas9,cas1,cas2 3 6 0 0
NZ_FZZH01000139 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000044 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FZZH01000078 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000026 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000218 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000204 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000098 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000060 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000217 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000067 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000124 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000096 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000035 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000178 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000200 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000184 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000029 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000075 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000190 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000119 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000125 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000216 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000162 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000095 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000048 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000114 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000007 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000021 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_FZZH01000109 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000019 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000071 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000163 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000205 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000106 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000082 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000099 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 1 crisprs NA 0 1 0 0
NZ_FZZH01000023 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_FZZH01000151 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000152 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000058 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000196 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000040 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000005 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000179 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000031 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_FZZH01000161 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000013 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_FZZH01000223 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000177 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000043 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000112 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000126 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000212 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000132 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000022 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000203 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000063 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000194 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000111 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000141 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000066 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000135 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000150 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000170 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_FZZH01000059 Neisseria meningitidis strain Neisseria meningitidis isolate R301, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_FZZH01000062
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000062_1 607-723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_FZZH01000021
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000021_1 15585-15694 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_FZZH01000033
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000033_1 18264-18959 TypeII NA
10 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_FZZH01000033_1 1.1|18300|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18300-18329 30 NZ_FZZH01000020.1 8626-8655 0 1.0
NZ_FZZH01000033_1 1.3|18432|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18432-18461 30 NZ_FZZH01000010.1 19796-19825 0 1.0
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 NZ_FZZH01000026.1 5119-5148 1 0.967

1. spacer 1.1|18300|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to position: 8626-8655, mismatch: 0, identity: 1.0

acgccgccaacctagtccacgactttgaaa	CRISPR spacer
acgccgccaacctagtccacgactttgaaa	Protospacer
******************************

2. spacer 1.3|18432|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to position: 19796-19825, mismatch: 0, identity: 1.0

tccacaggtttgttcaagccttagattttg	CRISPR spacer
tccacaggtttgttcaagccttagattttg	Protospacer
******************************

3. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to position: 5119-5148, mismatch: 1, identity: 0.967

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
gctcgccgcctgaataacggcgacaggtgt	Protospacer
*************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 383290-383319 4 0.867
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KX274135 Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence 31353-31382 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP013618 Staphylococcus aureus strain RIVM1295 plasmid pRIVM1295-2, complete sequence 1551-1580 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP013626 Staphylococcus aureus strain RIVM4296 plasmid pRIVM4296, complete sequence 2156-2185 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP029170 Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence 2687-2716 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP053078 Staphylococcus aureus strain SA01 plasmid pSA01-04, complete sequence 703-732 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MH785226 Staphylococcus aureus strain ph1 plasmid pRIVM1295-2, complete sequence 1495-1524 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_006872 Clostridium perfringens plasmid pBCNF5603 DNA, complete sequence 7436-7465 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP013044 Clostridium perfringens strain JP55 plasmid pJFP55J, complete sequence 7436-7465 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 KY554772 Lactococcus phage AM5, complete genome 19184-19213 6 0.8
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_049856 Lactococcus phage AM4, complete genome 101726-101755 6 0.8
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 MT261384 Salmonella virus PAT1, complete genome 13324-13353 7 0.767
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 MT580116 Salmonella phage 65FD, complete genome 29662-29691 7 0.767
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 MT580117 Salmonella phage 66FD, complete genome 20500-20529 7 0.767
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 NC_004775 Enterobacteria phage epsilon15, complete genome 29581-29610 7 0.767
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 976136-976165 7 0.767
NZ_FZZH01000033_1 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18498-18527 30 MK448946 Streptococcus phage Javan456, complete genome 30249-30278 7 0.767
NZ_FZZH01000033_1 1.5|18564|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18564-18593 30 NZ_CP034782 Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence 118054-118083 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT074137 Bacteroides phage DAC16, complete genome 19475-19504 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT074142 Bacteroides phage DAC23, complete genome 20325-20354 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT074141 Bacteroides phage DAC22, complete genome 21167-21196 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT074139 Bacteroides phage DAC19, complete genome 21079-21108 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT074140 Bacteroides phage DAC20, complete genome 21079-21108 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KY399975 Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence 21245-21274 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KY399974 Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence 21245-21274 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042356 Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence 10150-10179 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KJ812998 Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence 19475-19504 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KP900016 Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence 39956-39985 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KP868647 Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence 21246-21275 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP029731 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence 107066-107095 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KC887916 Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence 19475-19504 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_025184 Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence 100608-100637 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP044035 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence 107510-107539 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_004974 Fusobacterium nucleatum plasmid pFN1, complete sequence 5690-5719 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_021501 Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence 10148-10177 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MK933278 Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence 100608-100637 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP053690 Arthrobacter citreus strain NEB 577 plasmid pAciIRM, complete sequence 6015-6044 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP013337 Fusobacterium hwasookii ChDC F206 plasmid, complete sequence 231-260 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP053470 Fusobacterium nucleatum strain Fn12230 plasmid pFN1, complete sequence 1183-1212 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MH909345 Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence 51401-51430 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MG462729 Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence 19476-19505 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042350 Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence 10149-10178 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042354 Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence 10101-10130 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042353 Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence 9569-9598 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042351 Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence 9569-9598 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042352 Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence 9569-9598 7 0.767
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF042357 Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence 9763-9792 7 0.767
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 269294-269323 7 0.767
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 531080-531109 7 0.767
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 332039-332068 7 0.767
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 531213-531242 7 0.767
NZ_FZZH01000033_1 1.3|18432|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18432-18461 30 CP041751 Bacillus paranthracis strain NCCP 14796 plasmid unnamed1, complete sequence 47076-47105 8 0.733
NZ_FZZH01000033_1 1.5|18564|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18564-18593 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 172995-173024 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 14709-14738 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 39382-39411 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 15848-15877 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 24142-24171 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF580438 Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence 33848-33877 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_MF580438 Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence 37198-37227 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP044414 Lactobacillus sp. JM1 plasmid unnamed2, complete sequence 42032-42061 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP008839 Lactobacillus gasseri DSM 14869 plasmid pEB01-1, complete sequence 7298-7327 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MT774392 CrAssphage cr128_1, complete genome 6145-6174 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MN693954 Marine virus AFVG_250M569, complete genome 33564-33593 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP044544 Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence 117782-117811 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 114106-114135 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 507403-507432 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1875444-1875473 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 699902-699931 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 478670-478699 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 518238-518267 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 727314-727343 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP019318 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-6, complete sequence 25593-25622 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1838636-1838665 8 0.733
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 2542-2571 8 0.733
NZ_FZZH01000033_1 1.10|18894|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18894-18923 30 NZ_CP031709 Acinetobacter wuhouensis strain WCHA60 plasmid p1_010060, complete sequence 6094-6123 8 0.733
NZ_FZZH01000033_1 1.10|18894|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18894-18923 30 NZ_CP015617 Acinetobacter schindleri strain ACE plasmid p2AsACE, complete sequence 2623-2652 8 0.733
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 34537-34566 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 NC_015688 Clostridium acetobutylicum DSM 1731 plasmid pSMBb, complete sequence 1542-1571 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 KY554766 Lactococcus phage AM6, complete genome 15064-15093 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 87434-87463 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 LN681537 Clostridium phage phiCD211, complete genome 96296-96325 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 KY554767 Lactococcus phage AM7, complete genome 15064-15093 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP046723 Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence 344141-344170 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 265345-265374 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 517584-517613 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP034149 Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence 317429-317458 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 289164-289193 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 176873-176902 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 233390-233419 9 0.7
NZ_FZZH01000033_1 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18762-18791 30 NZ_CP025550 Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence 15027-15056 9 0.7
NZ_FZZH01000033_1 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT 18696-18725 30 MF417875 Uncultured Caudovirales phage clone 10S_11, partial genome 37465-37494 10 0.667

1. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.867

-ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gacctg-cggcagcgtcgatgacggcaaaag	Protospacer
  **** **** *********.*********

2. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX274135 (Staphylococcus arlettae strain SA-01 plasmid pSA-01, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

3. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013618 (Staphylococcus aureus strain RIVM1295 plasmid pRIVM1295-2, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

4. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013626 (Staphylococcus aureus strain RIVM4296 plasmid pRIVM4296, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

5. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029170 (Staphylococcus aureus strain PTDrAP2 plasmid pPTDrAP2c, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

6. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053078 (Staphylococcus aureus strain SA01 plasmid pSA01-04, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

7. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH785226 (Staphylococcus aureus strain ph1 plasmid pRIVM1295-2, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaataaagaagaattgaataaattactt	Protospacer
* . ***********.***********  *

8. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_006872 (Clostridium perfringens plasmid pBCNF5603 DNA, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tccaaaaaagaagaactaaataaatttagt	Protospacer
*   * ***********.******** ***

9. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013044 (Clostridium perfringens strain JP55 plasmid pJFP55J, complete sequence) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tccaaaaaagaagaactaaataaatttagt	Protospacer
*   * ***********.******** ***

10. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to KY554772 (Lactococcus phage AM5, complete genome) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ctgctaaaagaagaactaaaaaaattaagt	Protospacer
. **  ***********.** *********

11. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_049856 (Lactococcus phage AM4, complete genome) position: , mismatch: 6, identity: 0.8

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ctgctaaaagaagaactaaaaaaattaagt	Protospacer
. **  ***********.** *********

12. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
catcgccgccggagtaacggcgacaacctt	Protospacer
  ******** **.************ . *

13. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
catcgccgccggagtaacggcgacaacctt	Protospacer
  ******** **.************ . *

14. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
catcgccgccggagtaacggcgacaacctt	Protospacer
  ******** **.************ . *

15. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
catcgccgccggagtaacggcgacaacctt	Protospacer
  ******** **.************ . *

16. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
gctcgccgcctgaagcacggcgagcggctt	Protospacer
**************  *******  .*. *

17. spacer 1.4|18498|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 7, identity: 0.767

gctcgccgcctgaataacggcgacaagtgt	CRISPR spacer
cctacccgcctgaatatcggcgacgagttc	Protospacer
 **  *********** *******.*** .

18. spacer 1.5|18564|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 7, identity: 0.767

cgcccgagattttcgccattggtataattt	CRISPR spacer
tgcccgatatcttcgccattggtaaaggct	Protospacer
.****** **.************* *. .*

19. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT074137 (Bacteroides phage DAC16, complete genome) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttatctaaagaagaattgattaaattaaga	Protospacer
* .. **********.*** ********* 

20. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT074142 (Bacteroides phage DAC23, complete genome) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttatctaaagaagaattgattaaattaaga	Protospacer
* .. **********.*** ********* 

21. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT074141 (Bacteroides phage DAC22, complete genome) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttatctaaagaagaattgattaaattaaga	Protospacer
* .. **********.*** ********* 

22. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT074139 (Bacteroides phage DAC19, complete genome) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttatctaaagaagaattgattaaattaaga	Protospacer
* .. **********.*** ********* 

23. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT074140 (Bacteroides phage DAC20, complete genome) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttatctaaagaagaattgattaaattaaga	Protospacer
* .. **********.*** ********* 

24. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

25. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

26. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

27. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

28. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

29. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

30. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

31. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

32. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

33. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

34. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_004974 (Fusobacterium nucleatum plasmid pFN1, complete sequence) position: , mismatch: 7, identity: 0.767

tggcata-aagaagaactgaataaattaagt	CRISPR spacer
-agaatgcaagaagaactaaataaattaaaa	Protospacer
 .* **. **********.**********. 

35. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

36. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

37. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053690 (Arthrobacter citreus strain NEB 577 plasmid pAciIRM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
ttaaatcaagaagaactgaataatttatat	Protospacer
* . ** **************** *** .*

38. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013337 (Fusobacterium hwasookii ChDC F206 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

tggcata-aagaagaactgaataaattaagt	CRISPR spacer
-agaatgcaagaagaactaaataaattaaaa	Protospacer
 .* **. **********.**********. 

39. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053470 (Fusobacterium nucleatum strain Fn12230 plasmid pFN1, complete sequence) position: , mismatch: 7, identity: 0.767

tggcata-aagaagaactgaataaattaagt	CRISPR spacer
-agaatgcaagaagaactaaataaattaaaa	Protospacer
 .* **. **********.**********. 

40. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

41. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

42. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

43. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

44. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

45. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

46. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

47. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 7, identity: 0.767

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tgtcataaagaagaacttaataatatattc	Protospacer
** ************** *****  **  .

48. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 7, identity: 0.767

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gcttctcggctgcgtcgatggcgataaagc	Protospacer
 *.* ******************..***. 

49. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 7, identity: 0.767

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gcttctcggctgcgtcgatggcgataaagc	Protospacer
 *.* ******************..***. 

50. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 7, identity: 0.767

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
cttcgtcggcagcgacgatggcggcaatac	Protospacer
*...****** *** ************ * 

51. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 7, identity: 0.767

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gcttctcggctgcgtcgatggcgataaagc	Protospacer
 *.* ******************..***. 

52. spacer 1.3|18432|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to CP041751 (Bacillus paranthracis strain NCCP 14796 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tccacaggtttgttcaagccttagattttg	CRISPR spacer
tatccaggtttgttcaaaccctagattaaa	Protospacer
* . *************.**.******  .

53. spacer 1.5|18564|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.733

cgcccgagattttcgccattggtataattt	CRISPR spacer
tggccgaaattttcgtcattggtatagagg	Protospacer
.* ****.*******.**********.   

54. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aaaatgaaagaagaactgaataaagtaaat	Protospacer
 ..   ****************** ***.*

55. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aaaatgaaagaagaactgaataaagtaaat	Protospacer
 ..   ****************** ***.*

56. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aaaatgaaagaagaactgaataaagtaaat	Protospacer
 ..   ****************** ***.*

57. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aaaatgaaagaagaactgaataaagtaaat	Protospacer
 ..   ****************** ***.*

58. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF580438 (Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tatttagaagaggaactgaataaattaaat	Protospacer
*. .  .****.****************.*

59. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF580438 (Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tatttagaagaggaactgaataaattaaat	Protospacer
*. .  .****.****************.*

60. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044414 (Lactobacillus sp. JM1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
gatgttaaagcagaactaaataaattaaat	Protospacer
 .   ***** ******.**********.*

61. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008839 (Lactobacillus gasseri DSM 14869 plasmid pEB01-1, complete sequence) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
gatgttaaagcagaactaaataaattaaat	Protospacer
 .   ***** ******.**********.*

62. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MT774392 (CrAssphage cr128_1, complete genome) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
atttctaaagaagaattgaaaaaattaact	Protospacer
   . **********.**** ******* *

63. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MN693954 (Marine virus AFVG_250M569, complete genome) position: , mismatch: 8, identity: 0.733

tggcataaagaagaactgaataaattaagt	CRISPR spacer
tatattaaaaaagaactaaataaattaaaa	Protospacer
*.   ****.*******.**********. 

64. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044544 (Bradyrhizobium betae strain PL7HG1 plasmid pBbPL7HG1, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gtgccacggccgcgtcgatggcggcgaaag	Protospacer
 . .  ****.**************.****

65. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gccagtcggcggcgtcgatggcggtctcgg	Protospacer
 ** ****** *************.   .*

66. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
ccctgtcggcagcgccgatggcgctctgat	Protospacer
********** ***.******** .  .* 

67. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
ccctgtcggctccggcgatggcgccggccc	Protospacer
*********** ** ******** *..   

68. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
ggctgtcggctacggcgatggcggcggcgg	Protospacer
  *********.** **********.. .*

69. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tcctgtcggcggcgtcgctggcggaattcc	Protospacer
.********* ****** ****** *    

70. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tcctgtcggctgcggcgctggcggaattcc	Protospacer
.************* ** ****** *    

71. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
agctgtcggctgcggcgatgacggcctgcg	Protospacer
  ************ *****.****  . *

72. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019318 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-6, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
cggcctcggccgcgtcgatggcggcacagc	Protospacer
*  . *****.*************** *. 

73. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tgctggcggcggcgtcgatggcggcgaggt	Protospacer
. *** **** **************.*.. 

74. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.733

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
gccagtcggcggcgtcgatggcggtctcgg	Protospacer
 ** ****** *************.   .*

75. spacer 1.10|18894|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031709 (Acinetobacter wuhouensis strain WCHA60 plasmid p1_010060, complete sequence) position: , mismatch: 8, identity: 0.733

ttgagttttcatattttagaaccgccgtcc	CRISPR spacer
ttgagttttcatatttaagtacctgtttta	Protospacer
**************** ** ***  . *. 

76. spacer 1.10|18894|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015617 (Acinetobacter schindleri strain ACE plasmid p2AsACE, complete sequence) position: , mismatch: 8, identity: 0.733

ttgagttttcatattttagaaccgccgtcc	CRISPR spacer
ttgagttttcatatttaagtacctgtttta	Protospacer
**************** ** ***  . *. 

77. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aattgtaaagaagaactaattaaattaaag	Protospacer
 . ..************.* ********. 

78. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NC_015688 (Clostridium acetobutylicum DSM 1731 plasmid pSMBb, complete sequence) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
caaacgcaaaaagaactaaataaattaagt	Protospacer
...    **.*******.************

79. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to KY554766 (Lactococcus phage AM6, complete genome) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
gataataaagaagacctgaataaactattg	Protospacer
 .  ********** *********.**   

80. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aattgtaaagaagaactaattaaattaaag	Protospacer
 . ..************.* ********. 

81. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
aattgtaaagaagaactaattaaattaaag	Protospacer
 . ..************.* ********. 

82. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to KY554767 (Lactococcus phage AM7, complete genome) position: , mismatch: 9, identity: 0.7

tggcataaagaagaactgaataaattaagt	CRISPR spacer
gataataaagaagacctgaataaactattg	Protospacer
 .  ********** *********.**   

83. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046723 (Pantoea agglomerans strain ASB05 plasmid pASB05p1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

84. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

85. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

86. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034149 (Pantoea agglomerans strain L15 plasmid pPagL15_1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

87. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

88. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
tctggtcggcagcgtcgatggcggctggcc	Protospacer
.*. ****** ************** ..  

89. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
ccctgtcggatgcggcgatggcgaagcgga	Protospacer
********* **** ********. . ...

90. spacer 1.8|18762|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7

ccctgtcggctgcgtcgatggcggcaaaag	CRISPR spacer
cgaggtcggcggcgtcgatggcggcgtcga	Protospacer
*   ****** **************.  ..

91. spacer 1.7|18696|30|NZ_FZZH01000033|PILER-CR,CRISPRCasFinder,CRT matches to MF417875 (Uncultured Caudovirales phage clone 10S_11, partial genome) position: , mismatch: 10, identity: 0.667

tggcataaaga-agaactgaataaattaagt	CRISPR spacer
-aacgcaaaagtagaactgaataaattacta	Protospacer
 ..*..***.. ****************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_FZZH01000099
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000099_1 5491-5567 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_FZZH01000099_1 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder 5514-5544 31 NZ_CP018385 Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence 64466-64496 8 0.742
NZ_FZZH01000099_1 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder 5514-5544 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 382796-382826 9 0.71
NZ_FZZH01000099_1 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder 5514-5544 31 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 1029393-1029423 9 0.71
NZ_FZZH01000099_1 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder 5514-5544 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 548485-548515 9 0.71
NZ_FZZH01000099_1 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder 5514-5544 31 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 227234-227264 9 0.71

1. spacer 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

tgaatccgaacgcgtccgcacggaaacctat	CRISPR spacer
gcaatccgaacacgtcggcacggaaggcaag	Protospacer
  *********.**** ********. * * 

2. spacer 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 9, identity: 0.71

tgaatccgaacgcgtccgcacggaaacctat	CRISPR spacer
gagatccgaccgcatccgcacggaaaaatca	Protospacer
 ..****** ***.************  *  

3. spacer 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.71

tgaatccgaacgcgtccgcacggaaacctat	CRISPR spacer
cagatccgaccgcatccgcacggaaaagtcg	Protospacer
...****** ***.************  *  

4. spacer 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.71

tgaatccgaacgcgtccgcacggaaacctat	CRISPR spacer
cagatccgaccgcatccgcacggaaaaatcg	Protospacer
...****** ***.************  *  

5. spacer 1.1|5514|31|NZ_FZZH01000099|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 9, identity: 0.71

tgaatccgaacgcgtccgcacggaaacctat	CRISPR spacer
cagatccgatcgcatccgcacggaaaagtca	Protospacer
...****** ***.************  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_FZZH01000092
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000092_1 138-236 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_FZZH01000032
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000032_1 17295-17390 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_FZZH01000026
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_FZZH01000020
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_FZZH01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58079 : 67292 9 Burkholderia_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_FZZH01000055
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_FZZH01000055_1 12558-12659 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_FZZH01000010
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_FZZH01000003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 52459 : 62644 18 Vibrio_phage(25.0%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_FZZH01000003.1|WP_042743676.1|23403_23754_+|anti-CRISPR-protein-AcrIIC3 23403_23754_+ 116 aa aa AcrIIC3 NA NZ_FZZH01000003.1_24163_24373_+ No NA
NZ_FZZH01000003.1|WP_042743678.1|23799_24171_+|anti-CRISPR-protein-AcrIIC2 23799_24171_+ 123 aa aa NA NA NZ_FZZH01000003.1_24163_24373_+ No NA