Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032532 Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence 0 crisprs NA 0 0 0 0
CP032535 Bacillus megaterium NCT-2 plasmid pNCT2_7, complete sequence 0 crisprs NA 0 0 0 0
CP032534 Bacillus megaterium NCT-2 plasmid pNCT2_6, complete sequence 0 crisprs RT 0 0 1 0
CP032529 Bacillus megaterium NCT-2 plasmid pNCT2_10, complete sequence 0 crisprs NA 0 0 0 0
CP032533 Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence 0 crisprs RT,csa3 0 0 0 0
CP032530 Bacillus megaterium NCT-2 plasmid pNCT2_2, complete sequence 0 crisprs RT 0 0 0 0
CP032536 Bacillus megaterium NCT-2 plasmid pNCT2_8, complete sequence 0 crisprs NA 0 0 0 0
CP032537 Bacillus megaterium NCT-2 plasmid pNCT2_9, complete sequence 0 crisprs NA 0 0 0 0
CP032527 Bacillus megaterium NCT-2 chromosome, complete genome 4 crisprs DEDDh,cas3,RT,WYL,csa3,DinG,c2c4_V-U1 0 1 4 0
CP032531 Bacillus megaterium NCT-2 plasmid pNCT2_3, complete sequence 0 crisprs RT 0 0 1 0
CP032528 Bacillus megaterium NCT-2 plasmid pNCT2_1, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. CP032531
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30661 : 42329 11 Catovirus(37.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032527
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032527_3 2485591-2485683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032527_4 2485749-2485833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032527_5 2485906-2485990 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032527_6 2486216-2486424 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032527_8 8.1|5092725|34|CP032527|CRISPRCasFinder 5092725-5092758 34 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 347341-347374 10 0.706

1. spacer 8.1|5092725|34|CP032527|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.706

cggatctggctgagttccgtcaccttccccaggg	CRISPR spacer
tccggcaagctgagttccgtcgccttccacaggt	Protospacer
.  . * .*************.****** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 269087 : 279544 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 1138552 : 1147826 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 3235501 : 3243713 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_4 5173491 : 5181753 8 Synechococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP032534
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34737 : 43751 12 Bacillus_phage(40.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP032528
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 75861 : 129362 47 Bacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage