Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP011966 Clostridium beijerinckii NRRL B-598 chromosome, complete genome 2 crisprs DEDDh,RT,cas3,csa3,c2c10_CAS-V-U3,DinG,WYL 0 2 14 0

Results visualization

1. CP011966
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP011966_1 1111551-1111653 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP011966_2 4837244-4837340 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 MT446421 UNVERIFIED: Escherichia virus TH55, complete genome 42655-42687 6 0.818
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 MT446415 UNVERIFIED: Escherichia virus TH44, complete genome 128912-128944 6 0.818
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 MT446396 UNVERIFIED: Escherichia virus TH22, complete genome 6062-6094 6 0.818
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 MT611523 Escherichia phage DK-13, complete genome 72351-72383 6 0.818
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 AY682195 Lactobacillus plantarum bacteriophage LP65, complete genome 68176-68208 7 0.788
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 NC_006565 Lactobacillus phage LP65, complete genome 68176-68208 7 0.788
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 NZ_CP035169 Lactobacillus plantarum strain SRCM103418 plasmid unnamed1 56140-56172 9 0.727
CP011966_3 3.1|5709667|33|CP011966|CRISPRCasFinder 5709667-5709699 33 NZ_CP047122 Lactobacillus hilgardii strain FLUB plasmid unnamed1 23285-23317 9 0.727
CP011966_3 3.2|5709727|33|CP011966|CRISPRCasFinder 5709727-5709759 33 KC821604 Cellulophaga phage phiST, complete genome 48350-48382 11 0.667
CP011966_3 3.2|5709727|33|CP011966|CRISPRCasFinder 5709727-5709759 33 KC821621 Cellulophaga phage phi19:2, complete genome 48359-48391 11 0.667
CP011966_3 3.2|5709727|33|CP011966|CRISPRCasFinder 5709727-5709759 33 KC821625 Cellulophaga phage phi13:1, complete genome 46260-46292 11 0.667
CP011966_3 3.2|5709727|33|CP011966|CRISPRCasFinder 5709727-5709759 33 HQ634192 Cellulophaga phage phiST genomic sequence 30544-30576 11 0.667

1. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to MT446421 (UNVERIFIED: Escherichia virus TH55, complete genome) position: , mismatch: 6, identity: 0.818

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gaaagttccattttcagttaaccaaccagaagc	Protospacer
************ *** ************    

2. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 6, identity: 0.818

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gaaagttccattttcagttaaccaaccagaagc	Protospacer
************ *** ************    

3. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to MT446396 (UNVERIFIED: Escherichia virus TH22, complete genome) position: , mismatch: 6, identity: 0.818

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gaaagttccattttcagttaaccaaccagaagc	Protospacer
************ *** ************    

4. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to MT611523 (Escherichia phage DK-13, complete genome) position: , mismatch: 6, identity: 0.818

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gaaagttccattttcagttaaccaaccagaagc	Protospacer
************ *** ************    

5. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to AY682195 (Lactobacillus plantarum bacteriophage LP65, complete genome) position: , mismatch: 7, identity: 0.788

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gtacgtttcattgtcatttatccaaccattatc	Protospacer
* * ***.************ ******* * * 

6. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to NC_006565 (Lactobacillus phage LP65, complete genome) position: , mismatch: 7, identity: 0.788

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
gtacgtttcattgtcatttatccaaccattatc	Protospacer
* * ***.************ ******* * * 

7. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to NZ_CP035169 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
ttaagttccattgtcttttaacgaaccaaggct	Protospacer
  ************* ****** *****.  . 

8. spacer 3.1|5709667|33|CP011966|CRISPRCasFinder matches to NZ_CP047122 (Lactobacillus hilgardii strain FLUB plasmid unnamed1) position: , mismatch: 9, identity: 0.727

gaaagttccattgtcatttaaccaaccagtttg	CRISPR spacer
ttaagttccattgtcttttaacgaaccaaggct	Protospacer
  ************* ****** *****.  . 

9. spacer 3.2|5709727|33|CP011966|CRISPRCasFinder matches to KC821604 (Cellulophaga phage phiST, complete genome) position: , mismatch: 11, identity: 0.667

ccaagttgctccatcttgaacccaacctgtagc	CRISPR spacer
gttagttgctccatctgaaacccaaccaaattt	Protospacer
 . ************* .********* .   .

10. spacer 3.2|5709727|33|CP011966|CRISPRCasFinder matches to KC821621 (Cellulophaga phage phi19:2, complete genome) position: , mismatch: 11, identity: 0.667

ccaagttgctccatcttgaacccaacctgtagc	CRISPR spacer
gttagttgctccatctgaaacccaaccaaattt	Protospacer
 . ************* .********* .   .

11. spacer 3.2|5709727|33|CP011966|CRISPRCasFinder matches to KC821625 (Cellulophaga phage phi13:1, complete genome) position: , mismatch: 11, identity: 0.667

ccaagttgctccatcttgaacccaacctgtagc	CRISPR spacer
gttagttgctccatctgaaacccaaccaaattt	Protospacer
 . ************* .********* .   .

12. spacer 3.2|5709727|33|CP011966|CRISPRCasFinder matches to HQ634192 (Cellulophaga phage phiST genomic sequence) position: , mismatch: 11, identity: 0.667

ccaagttgctccatcttgaacccaacctgtagc	CRISPR spacer
gttagttgctccatctgaaacccaaccaaattt	Protospacer
 . ************* .********* .   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 422062 : 484933 58 Clostridium_phage(13.33%) coat,protease NA
DBSCAN-SWA_2 1002601 : 1016069 23 Clostridium_phage(60.0%) integrase attL 1004159:1004174|attR 1013261:1013276
DBSCAN-SWA_3 1171266 : 1181493 7 Cyanophage(28.57%) NA NA
DBSCAN-SWA_4 1215150 : 1226668 11 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_5 1656733 : 1715093 49 Staphylococcus_prophage(20.0%) transposase,coat,protease NA
DBSCAN-SWA_6 1926553 : 1989165 59 Klosneuvirus(16.67%) tRNA,transposase,holin,integrase attL 1945461:1945480|attR 1999007:1999026
DBSCAN-SWA_7 2493362 : 2497845 6 Clostridium_virus(16.67%) NA NA
DBSCAN-SWA_8 2553798 : 2560519 12 Clostridium_phage(37.5%) NA NA
DBSCAN-SWA_9 2921059 : 2953993 35 uncultured_Caudovirales_phage(42.86%) terminase,portal,plate,tail,capsid NA
DBSCAN-SWA_10 3200306 : 3253897 41 uncultured_Caudovirales_phage(20.0%) transposase,integrase,protease attL 3192431:3192456|attR 3247493:3247518
DBSCAN-SWA_11 3805118 : 3810927 8 Clostridium_phage(28.57%) NA NA
DBSCAN-SWA_12 3983488 : 4018805 35 Clostridium_phage(68.75%) tRNA,terminase,portal,plate,tail NA
DBSCAN-SWA_13 5778647 : 5853278 58 Bacillus_phage(18.18%) transposase,integrase,protease attL 5771638:5771654|attR 5800474:5800490
DBSCAN-SWA_14 5865312 : 5874833 13 Clostridium_phage(37.5%) integrase attL 5860444:5860460|attR 5887196:5887212
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage