1. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_017533 (Pantoea ananatis AJ13355 plasmid pEA320, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
2. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014208 (Pantoea ananatis strain R100 plasmid, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
3. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to CP054909 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
4. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035036 (Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
5. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_016817 (Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
6. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020944 (Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
7. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
8. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022429 (Pantoea ananatis strain YJ76 plasmid p_unamed1) position: , mismatch: 4, identity: 0.871
tggtcagagctttatcccgctgtc-gatgtgc CRISPR spacer
tggtcagcgctttatcccgctgtcggatatt- Protospacer
******* **************** ***.*
9. spacer 1.20|525927|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MN694398 (Marine virus AFVG_250M315, complete genome) position: , mismatch: 7, identity: 0.781
aatacggcacttttttaaagaa-cataggcact CRISPR spacer
aatacggcacttttttccagaaccactgatac- Protospacer
**************** **** **. *..**
10. spacer 2.9|1186686|36|CP033381|CRISPRCasFinder matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.806
tgtcgctgcagaagattctcgggcatgccgatatcg CRISPR spacer
tggcattgcagacgattctcgggcacgccgatttag Protospacer
** *..****** ************.****** * *
11. spacer 1.1|524769|31|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.742
tggtcagagctttatcccgctgtcgatgtgc CRISPR spacer
ctctcagagctttatcgcgctgtcgcagccc Protospacer
. ************* ******** *. *
12. spacer 1.2|524829|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.75
agtccgctgccgccgcacaagttgctgccgac CRISPR spacer
aggggcttgccgcagcacaagtcgctgccgag Protospacer
** .****** ********.********
13. spacer 1.2|524829|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.75
agtccgctgccgccgcacaagttgctgccgac CRISPR spacer
aggggcttgccgctgcacaagtcgctgccgag Protospacer
** .******.********.********
14. spacer 1.4|524951|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_049930 (Enterococcus phage vB_EfaP_Zip, complete genome) position: , mismatch: 8, identity: 0.75
attgatttgatcttgaggtaaagctgagtcat CRISPR spacer
atttacttgatcttgaggtaaagtagtattag Protospacer
*** *.*****************. * .*.*
15. spacer 1.4|524951|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_049931 (Enterococcus phage vB_EfaP_IME199, complete genome) position: , mismatch: 8, identity: 0.75
attgatttgatcttgaggtaaagctgagtcat CRISPR spacer
attcacttgatcttgaggtaaagtagtgtttg Protospacer
*** *.*****************. * **.
16. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
17. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
18. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
19. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
20. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
21. spacer 1.5|525012|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ccccggcagcgattatgacccggcgagtttcc CRISPR spacer
ccccggcagcgtttgtgacccggcttgcgaac Protospacer
*********** **.********* *. *
22. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgccggaaatcgtcgcggttattttaaa CRISPR spacer
gcgacgccggaaaacggcgcggtgttcgtatt Protospacer
************* ** ****** *. **
23. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.75
gcgacgccggaaatcgtcgcggttattttaaa-- CRISPR spacer
gccacgccggaaatcgccgcggt--gctcaagct Protospacer
** *************.****** .*.**.
24. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to GQ981382 (Shigella phage SP18, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
25. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MT446422 (UNVERIFIED: Escherichia virus TH57, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
26. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_028925 (Enterobacteria phage vB_EcoM_VR25, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
27. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
28. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MT533174 (Escherichia phage CJ20, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
29. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_028957 (Enterobacteria phage vB_EcoM_VR26, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
30. spacer 1.17|525743|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MT446420 (UNVERIFIED: Escherichia virus TH54, complete genome) position: , mismatch: 8, identity: 0.75
caccatagcatagccagaataaacagaaaaac CRISPR spacer
ccaaacgggatagccagaataagcagacaaac Protospacer
* *..* *************.**** ****
31. spacer 1.21|525988|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 8, identity: 0.75
gctttggccagcttgtcggcggattgggtaat CRISPR spacer
cttgcgctaagcatgtcggcggattgggtaat Protospacer
.* .* . *** *******************
32. spacer 1.32|526660|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
ttgtgcccgtcttgcaatgggtctggtgttaa- CRISPR spacer
cgatgcccgtcttgccatcggtctgg-gtcacg Protospacer
. .************ ** ******* **.*
33. spacer 1.42|527270|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MT662115 (Vibrio phage ValB1MD-2, complete genome) position: , mismatch: 8, identity: 0.75
ccggtggcattgggttatgaccctagccgcac CRISPR spacer
gaagtatggttgggttatgaccctagccgaac Protospacer
.**. .******************** **
34. spacer 1.45|527453|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046053 (Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcaaacgcctgcaagaagccatcgacgaa CRISPR spacer
acgcgaaacgcctgctggaagccatcgatcag Protospacer
.** ********** .***********. *.
35. spacer 1.48|527636|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040258 (Moraxella osloensis strain MOXF1 plasmid pMOXF1, complete sequence) position: , mismatch: 8, identity: 0.75
tcaaacaaacatcctacttatggtttgccaag CRISPR spacer
tctaacaaacatcctatttatggatgaaacag Protospacer
** *************.****** * . **
36. spacer 1.55|528063|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010619 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_b, complete sequence) position: , mismatch: 8, identity: 0.75
caccaatccaaaaaggcaaccaacgcaaagtg---- CRISPR spacer
caccaatcgaaaaaggaaacca----aacatggctc Protospacer
******** ******* ***** ** .**
37. spacer 1.63|528551|32|CP033381|CRISPRCasFinder,CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ggttatgtcgcacctaattctggcgctgtagc CRISPR spacer
gcttcctgagcaccaaattctggcgctggagc Protospacer
* ** . ***** ************* ***
38. spacer 1.63|528551|32|CP033381|CRISPRCasFinder,CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ggttatgtcgcacctaattctggcgctgtagc CRISPR spacer
gcttcctgagcaccaaattctggcgctggagc Protospacer
* ** . ***** ************* ***
39. spacer 2.2|1186685|37|CP033381|PILER-CR,CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.784
gtgtcgctgcagaagattctcgggcatgccgatatcg CRISPR spacer
ttggcattgcagacgattctcgggcacgccgatttag Protospacer
** *..****** ************.****** * *
40. spacer 1.4|524951|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN693414 (Marine virus AFVG_25M246, complete genome) position: , mismatch: 9, identity: 0.719
attgatttgatcttgaggtaaagctgagtcat CRISPR spacer
tttgatctgatcttgaggtaaagatggcaaga Protospacer
*****.**************** **. .
41. spacer 1.4|524951|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN693065 (Marine virus AFVG_25M245, complete genome) position: , mismatch: 9, identity: 0.719
attgatttgatcttgaggtaaagctgagtcat CRISPR spacer
tttgatctgatcttgaggtaaagatggcaaga Protospacer
*****.**************** **. .
42. spacer 1.4|524951|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN693042 (Marine virus AFVG_25M244, complete genome) position: , mismatch: 9, identity: 0.719
attgatttgatcttgaggtaaagctgagtcat CRISPR spacer
tttgatctgatcttgaggtaaagatggcaaga Protospacer
*****.**************** **. .
43. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_025442 (Salmonella phage Chi, complete genome) position: , mismatch: 9, identity: 0.719
gcgacgccggaaatcgtcgcggttattttaaa CRISPR spacer
ggcacgccggaaatcatcgcgtttatggatat Protospacer
* ************.***** **** *
44. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to JX094499 (Enterobacteria phage Chi, complete genome) position: , mismatch: 9, identity: 0.719
gcgacgccggaaatcgtcgcggttattttaaa CRISPR spacer
ggcacgccggaaatcatcgcgtttatggatat Protospacer
* ************.***** **** *
45. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_026603 (Mycobacterium phage Keshu, complete genome) position: , mismatch: 9, identity: 0.719
gcgacgccggaaatcgtcgcggttattttaaa CRISPR spacer
ccaacgccggaaaccgtcgcgggtatggaact Protospacer
*.**********.******** *** *
46. spacer 1.12|525438|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719
tcaatgcagttctttccagttatctgcataaa CRISPR spacer
gaaatgcagttcgttccagttatccgcgagtg Protospacer
********** ***********.**. . .
47. spacer 1.12|525438|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN693247 (Marine virus AFVG_25M51, complete genome) position: , mismatch: 9, identity: 0.719
tcaatgcagttctttccagttatctgcataaa CRISPR spacer
ttcgtttctttctttacagttatctgcagaaa Protospacer
*. .* . ****** ************ ***
48. spacer 1.15|525621|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 9, identity: 0.719
cctcgacaagttggggaactggattagagcag CRISPR spacer
cgaggacaagatggggcactggattagcgatc Protospacer
* ****** ***** ********** *
49. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX009060 (Pseudomonas syringae pv. actinidiae strain RT594 plasmid pUR_RT594, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cctgtcgagttcatcatcactcagtcgttctt Protospacer
...**. ***********.****** **** .
50. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX009063 (Pseudomonas syringae pv. actinidiae strain RT811 plasmid pPU_RT811, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cctgtcgagttcatcatcactcagtcgttctt Protospacer
...**. ***********.****** **** .
51. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX009062 (Pseudomonas syringae pv. actinidiae strain B4A plasmid pUR_B4A, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cctgtcgagttcatcatcactcagtcgttctt Protospacer
...**. ***********.****** **** .
52. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX009061 (Pseudomonas syringae pv. actinidiae strain RT652 plasmid pUR_RT652, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cctgtcgagttcatcatcactcagtcgttctt Protospacer
...**. ***********.****** **** .
53. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017011 (Pseudomonas syringae pv. actinidiae strain NZ-47 plasmid pPsa22180b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cctgtcgagttcatcatcactcagtcgttctt Protospacer
...**. ***********.****** **** .
54. spacer 1.18|525804|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgtttagttcatcatcgctcagtggttcgc CRISPR spacer
cacctcgagttcatcatcggtcagcggttcag Protospacer
. * *. ************ ****.*****.
55. spacer 1.31|526599|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cttagagcatgaccgacacaacggctcaaccg CRISPR spacer
gccaaagcatgaccggcacaaaggctcatttg Protospacer
..*.**********.***** ****** ..*
56. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026783 (Shigella dysenteriae strain 08-3380 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
57. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024469 (Shigella dysenteriae strain BU53M1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
58. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026767 (Shigella boydii strain 59-248 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
59. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026787 (Shigella dysenteriae strain NCTC 9718 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
60. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
61. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
62. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026826 (Shigella dysenteriae strain ATCC 12021 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
63. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to CP046677 (Escherichia coli strain 152661 plasmid p152661_pINV, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
64. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026837 (Shigella boydii strain ATCC 49812 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
65. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026775 (Shigella dysenteriae strain ATCC 13313 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
66. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
67. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045785 (Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
68. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026829 (Shigella dysenteriae strain ATCC 12037 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
69. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_007607 (Shigella dysenteriae Sd197 plasmid pSD1_197, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
70. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011417 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
71. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_022899 (Shigella dysenteriae 1617 plasmid pSLG231, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
72. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026779 (Shigella dysenteriae strain 69-3818 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
73. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026785 (Shigella dysenteriae strain 80-547 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
74. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
75. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026830 (Shigella dysenteriae strain ATCC 12039 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
tccggtaataaacggagcgggctatttttttg Protospacer
.*.* . . ************** ***** **
76. spacer 1.35|526843|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgactaagcgggaagtgcgcgagggtttgca CRISPR spacer
tatccttggcggcatgtgcgcgagggtttgcc Protospacer
. ** .**** * ****************
77. spacer 1.36|526904|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgacgatgccgccgagcatggataaaacgaa CRISPR spacer
ctggcgatgccgccgagcacggagacactcgc Protospacer
***.***************.*** * * . .
78. spacer 1.41|527209|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ttgcgcgcgggattttgcgcttggccagaatt CRISPR spacer
gcgcgcgcgggattttgcgctcgacctctcgt Protospacer
.*******************.*.** *
79. spacer 1.45|527453|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to AP014300 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S28-C6, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
gcggcaaacgcctgcaagaagccatcgacgaa CRISPR spacer
tgagcgaacggctgcaagaagccatcgatcgc Protospacer
.**.**** *****************. .
80. spacer 1.2|524829|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to NC_042086 (Corynebacterium phage Darwin, complete genome) position: , mismatch: 10, identity: 0.688
agtccgctgccgccgcacaagttgctgccgac CRISPR spacer
ctgaccctgccgccgcccaagatgctgccacg Protospacer
* ********** **** *******.
81. spacer 1.10|525316|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to CP021184 (Sphingomonas wittichii DC-6 plasmid pDC03, complete sequence) position: , mismatch: 10, identity: 0.688
gcgacgccggaaatcgtcgcggttattttaaa CRISPR spacer
gcgaagccggaaatagtcgcggtggagggtca Protospacer
**** ********* ******** . *
82. spacer 1.12|525438|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.688
tcaatgcagttctttccagttatctgcataaa CRISPR spacer
gaagtgcagttcgttccagttatcggcgagtg Protospacer
*.******** *********** **. . .
83. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to KX855962 (Arthrobacter phage HumptyDumpty, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
84. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MF185721 (Arthrobacter phage Kabreeze, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
85. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to KX522650 (Arthrobacter Phage Conboy, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
86. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN204503 (Arthrobacter phage Linus, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
87. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MF185723 (Arthrobacter phage RosiePosie, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
88. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to KX670787 (Arthrobacter phage Chocolat, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
89. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MF668274 (Arthrobacter phage JayCookie, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
90. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MK494107 (Arthrobacter phage Chipper1996, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
91. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MF185724 (Arthrobacter phage Scavito, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
92. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MN204499 (Arthrobacter phage Mordred, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
93. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to MF185725 (Arthrobacter phage Tophat, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
94. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to KU160660 (Arthrobacter phage PrincessTrina, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
95. spacer 1.14|525560|32|CP033381|PILER-CR,CRISPRCasFinder,CRT matches to KX855961 (Arthrobacter phage EdgarPoe, complete genome) position: , mismatch: 10, identity: 0.688
ctcatgcccactttgtcgcctttaatttcttc CRISPR spacer
ttcatgccctctttgtcgcccttacggaacgc Protospacer
.******** **********.*** . *
96. spacer 1.20|525927|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_021183 (Clostridium pasteurianum BC1 plasmid pCLOPA01, complete sequence) position: , mismatch: 10, identity: 0.688
aatacggcacttttttaaagaacataggcact CRISPR spacer
gctacggcactttttaaaagaatattccaata Protospacer
. ************* ******.** *.
97. spacer 1.21|525988|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 10, identity: 0.688
gctttggccagcttgtcggcggattgggtaat CRISPR spacer
agcgcggccagctcgtcggcggagtgggcctt Protospacer
. . .********.********* ****. *
98. spacer 1.21|525988|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010872 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence) position: , mismatch: 10, identity: 0.688
gctttggccagcttgtcggcggattgggtaat CRISPR spacer
gcttgggccagctcgtcggcggagagaacgcg Protospacer
**** ********.********* *....
99. spacer 1.33|526721|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccaaaattgcatctgtgctatgcgctggggat CRISPR spacer
caccgcctgcatctgttcgatgcgctggggga Protospacer
* . .********* * ***********.
100. spacer 1.36|526904|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.688
ctgacgatgccgccgagcatggataaaacgaa CRISPR spacer
ctggcgatgccgccgagcacggagacgctcgc Protospacer
***.***************.*** * . . .
101. spacer 1.36|526904|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.688
ctgacgatgccgccgagcatggataaaacgaa CRISPR spacer
ctggcgatgccgccgagcacggagacgctcgc Protospacer
***.***************.*** * . . .
102. spacer 1.36|526904|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ctgacgatgccgccgagcatggataaaacgaa CRISPR spacer
ctggcgatgccgccgagcacggagacgctcgc Protospacer
***.***************.*** * . . .
103. spacer 1.36|526904|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 10, identity: 0.688
ctgacgatgccgccgagcatggataaaacgaa CRISPR spacer
ctggcgatgccgccgagcacggagacgctcgc Protospacer
***.***************.*** * . . .
104. spacer 1.44|527392|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022421 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-6, complete sequence) position: , mismatch: 10, identity: 0.688
aattgaatacatcgcaacaaaagaccgtgaaa CRISPR spacer
agaagaagacatcgcaacaaaaggccgaagcc Protospacer
*. *** ***************.*** ..
105. spacer 1.45|527453|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to MN694306 (Marine virus AFVG_250M113, complete genome) position: , mismatch: 10, identity: 0.688
gcggcaaacgcctgcaagaagccatcgacgaa CRISPR spacer
ctgatgaaagcttgcaagaagccatcgacttg Protospacer
.*...** **.***************** .
106. spacer 1.53|527941|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to AP014063 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C13-MedDCM-OCT-S32-C51, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
gcgagtttaacggcaacgcttacaactacgtg CRISPR spacer
tcgtgtttgacggcaacgcttacacgcgtttc Protospacer
** ****.*************** ... *
107. spacer 1.57|528185|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018257 (Calothrix sp. NIES-4071 plasmid plasmid2 DNA, complete genome) position: , mismatch: 10, identity: 0.688
cgggtaagcaccgctttttgtgagccttcgcc CRISPR spacer
gattttagcaccgctttttgtgaaccatcttt Protospacer
. * *****************.** ** ..
108. spacer 1.34|526782|32|CP033381|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 11, identity: 0.656
cctgcccggaaacggagcgggctttttttatg CRISPR spacer
cctgccctggaacggagcgggctgggcgctga Protospacer
******* *.************* . . .
