Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026068 Staphylococcus aureus strain NRS146 chromosome, complete genome 11 crisprs cas3,DEDDh,DinG,csa3,WYL 10 3 6 0

Results visualization

1. CP026068
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_1 115286-115378 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_2 178548-178646 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_3 320777-320858 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_4 369632-369914 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_5 503316-503403 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_6 1239661-1239871 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_7 1362199-1362326 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_8 1396356-1396434 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_9 1588437-1588526 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_10 1712364-1712557 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026068_11 2577549-2577649 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026068_3 3.1|320801|34|CP026068|CRISPRCasFinder 320801-320834 34 CP026068.1 795969-796002 0 1.0
CP026068_3 3.1|320801|34|CP026068|CRISPRCasFinder 320801-320834 34 CP026068.1 884411-884444 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 272056-272075 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 272111-272130 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 277716-277735 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 277774-277793 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 277832-277851 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 320855-320874 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 389313-389332 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 513299-513318 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 795870-795889 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 884524-884543 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1060887-1060906 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1239585-1239604 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1397786-1397805 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1904208-1904227 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 2155154-2155173 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 2312973-2312992 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 2456171-2456190 0 1.0
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 2539067-2539086 0 1.0
CP026068_10 10.2|1712443|36|CP026068|CRT 1712443-1712478 36 CP026068.1 587761-587796 0 1.0
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 277501-277526 1 0.962
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 369606-369631 1 0.962
CP026068_4 4.3|369776|26|CP026068|CRT 369776-369801 26 CP026068.1 277613-277638 1 0.962
CP026068_6 6.1|1239699|21|CP026068|CRT 1239699-1239719 21 CP026068.1 1239640-1239660 1 0.952
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 284922-284941 1 0.95
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 587765-587784 1 0.95
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 845196-845215 1 0.95
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1094853-1094872 1 0.95
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 1407135-1407154 1 0.95
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 2456225-2456244 1 0.95
CP026068_6 6.3|1239816|18|CP026068|CRT 1239816-1239833 18 CP026068.1 1239643-1239660 1 0.944
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 277593-277625 1 0.97
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 795924-795956 1 0.97
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 1060936-1060968 1 0.97
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 1989779-1989811 1 0.97
CP026068_10 10.2|1712443|36|CP026068|CRT 1712443-1712478 36 CP026068.1 1239581-1239616 1 0.972
CP026068_10 10.3|1712502|33|CP026068|CRT 1712502-1712534 33 CP026068.1 277537-277569 1 0.97
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 240921-240946 2 0.923
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 277557-277582 2 0.923
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 587803-587828 2 0.923
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 2155054-2155079 2 0.923
CP026068_4 4.1|369662|26|CP026068|CRT 369662-369687 26 CP026068.1 2155110-2155135 2 0.923
CP026068_4 4.3|369776|26|CP026068|CRT 369776-369801 26 CP026068.1 2538936-2538961 2 0.923
CP026068_6 6.2|1239758|20|CP026068|CRT 1239758-1239777 20 CP026068.1 245521-245540 2 0.9
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 277537-277569 2 0.939
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 CP026068.1 884457-884489 2 0.939
CP026068_10 10.1|1712387|33|CP026068|CRT 1712387-1712419 33 CP026068.1 277593-277625 2 0.939
CP026068_10 10.1|1712387|33|CP026068|CRT 1712387-1712419 33 CP026068.1 795924-795956 2 0.939
CP026068_10 10.1|1712387|33|CP026068|CRT 1712387-1712419 33 CP026068.1 884457-884489 2 0.939
CP026068_10 10.1|1712387|33|CP026068|CRT 1712387-1712419 33 CP026068.1 1989779-1989811 2 0.939
CP026068_10 10.2|1712443|36|CP026068|CRT 1712443-1712478 36 CP026068.1 1060875-1060910 2 0.944
CP026068_10 10.2|1712443|36|CP026068|CRT 1712443-1712478 36 CP026068.1 1407123-1407158 2 0.944
CP026068_10 10.3|1712502|33|CP026068|CRT 1712502-1712534 33 CP026068.1 277481-277513 2 0.939
CP026068_10 10.3|1712502|33|CP026068|CRT 1712502-1712534 33 CP026068.1 277593-277625 2 0.939
CP026068_10 10.3|1712502|33|CP026068|CRT 1712502-1712534 33 CP026068.1 795924-795956 2 0.939
CP026068_10 10.3|1712502|33|CP026068|CRT 1712502-1712534 33 CP026068.1 1989779-1989811 2 0.939

1. spacer 3.1|320801|34|CP026068|CRISPRCasFinder matches to position: 795969-796002, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 3.1|320801|34|CP026068|CRISPRCasFinder matches to position: 884411-884444, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 6.2|1239758|20|CP026068|CRT matches to position: 272056-272075, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

4. spacer 6.2|1239758|20|CP026068|CRT matches to position: 272111-272130, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

5. spacer 6.2|1239758|20|CP026068|CRT matches to position: 277716-277735, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

6. spacer 6.2|1239758|20|CP026068|CRT matches to position: 277774-277793, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

7. spacer 6.2|1239758|20|CP026068|CRT matches to position: 277832-277851, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

8. spacer 6.2|1239758|20|CP026068|CRT matches to position: 320855-320874, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

9. spacer 6.2|1239758|20|CP026068|CRT matches to position: 389313-389332, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

10. spacer 6.2|1239758|20|CP026068|CRT matches to position: 513299-513318, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

11. spacer 6.2|1239758|20|CP026068|CRT matches to position: 795870-795889, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

12. spacer 6.2|1239758|20|CP026068|CRT matches to position: 884524-884543, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

13. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1060887-1060906, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

14. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1239585-1239604, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

15. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1397786-1397805, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

16. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1904208-1904227, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

17. spacer 6.2|1239758|20|CP026068|CRT matches to position: 2155154-2155173, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

18. spacer 6.2|1239758|20|CP026068|CRT matches to position: 2312973-2312992, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

19. spacer 6.2|1239758|20|CP026068|CRT matches to position: 2456171-2456190, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

20. spacer 6.2|1239758|20|CP026068|CRT matches to position: 2539067-2539086, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

21. spacer 10.2|1712443|36|CP026068|CRT matches to position: 587761-587796, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

22. spacer 4.1|369662|26|CP026068|CRT matches to position: 277501-277526, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagctggcgg	Protospacer
*****************.********

23. spacer 4.1|369662|26|CP026068|CRT matches to position: 369606-369631, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

24. spacer 4.3|369776|26|CP026068|CRT matches to position: 277613-277638, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

25. spacer 6.1|1239699|21|CP026068|CRT matches to position: 1239640-1239660, mismatch: 1, identity: 0.952

agctggccaatagtcagcttt	CRISPR spacer
agctggccaatagttagcttt	Protospacer
**************.******

26. spacer 6.2|1239758|20|CP026068|CRT matches to position: 284922-284941, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaatgaaattct	Protospacer
*********** ********

27. spacer 6.2|1239758|20|CP026068|CRT matches to position: 587765-587784, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcaaaaagaaattct	Protospacer
*******.************

28. spacer 6.2|1239758|20|CP026068|CRT matches to position: 845196-845215, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gattttcgaaaagaaattct	Protospacer
** *****************

29. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1094853-1094872, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgtaaagaaattct	Protospacer
******** ***********

30. spacer 6.2|1239758|20|CP026068|CRT matches to position: 1407135-1407154, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaggaaattct	Protospacer
***********.********

31. spacer 6.2|1239758|20|CP026068|CRT matches to position: 2456225-2456244, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaaattcgaaaagaaattct	Protospacer
*** ****************

32. spacer 6.3|1239816|18|CP026068|CRT matches to position: 1239643-1239660, mismatch: 1, identity: 0.944

tggccaatagtcagcttt	CRISPR spacer
tggccaatagttagcttt	Protospacer
***********.******

33. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 277593-277625, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

34. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 795924-795956, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

35. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 1060936-1060968, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

36. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 1989779-1989811, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

37. spacer 10.2|1712443|36|CP026068|CRT matches to position: 1239581-1239616, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

38. spacer 10.3|1712502|33|CP026068|CRT matches to position: 277537-277569, mismatch: 1, identity: 0.97

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgactttccgtcagcttctg	Protospacer
*********************.***********

39. spacer 4.1|369662|26|CP026068|CRT matches to position: 240921-240946, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

40. spacer 4.1|369662|26|CP026068|CRT matches to position: 277557-277582, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagctgacgg	Protospacer
*****************.****.***

41. spacer 4.1|369662|26|CP026068|CRT matches to position: 587803-587828, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

42. spacer 4.1|369662|26|CP026068|CRT matches to position: 2155054-2155079, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

43. spacer 4.1|369662|26|CP026068|CRT matches to position: 2155110-2155135, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

44. spacer 4.3|369776|26|CP026068|CRT matches to position: 2538936-2538961, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

45. spacer 6.2|1239758|20|CP026068|CRT matches to position: 245521-245540, mismatch: 2, identity: 0.9

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcaaaaaggaattct	Protospacer
*******.*****.******

46. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 277537-277569, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgactttccgtcagcttctg	Protospacer
******.*************.************

47. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to position: 884457-884489, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

48. spacer 10.1|1712387|33|CP026068|CRT matches to position: 277593-277625, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

49. spacer 10.1|1712387|33|CP026068|CRT matches to position: 795924-795956, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

50. spacer 10.1|1712387|33|CP026068|CRT matches to position: 884457-884489, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

51. spacer 10.1|1712387|33|CP026068|CRT matches to position: 1989779-1989811, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

52. spacer 10.2|1712443|36|CP026068|CRT matches to position: 1060875-1060910, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

53. spacer 10.2|1712443|36|CP026068|CRT matches to position: 1407123-1407158, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

54. spacer 10.3|1712502|33|CP026068|CRT matches to position: 277481-277513, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgactttccgccagcttctg	Protospacer
*********************.*.*********

55. spacer 10.3|1712502|33|CP026068|CRT matches to position: 277593-277625, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

56. spacer 10.3|1712502|33|CP026068|CRT matches to position: 795924-795956, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

57. spacer 10.3|1712502|33|CP026068|CRT matches to position: 1989779-1989811, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026068_4 4.4|369832|53|CP026068|CRT 369832-369884 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
CP026068_4 4.3|369776|26|CP026068|CRT 369776-369801 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP026068_8 8.1|1396379|33|CP026068|CRISPRCasFinder 1396379-1396411 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 4.4|369832|53|CP026068|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 4.3|369776|26|CP026068|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

3. spacer 8.1|1396379|33|CP026068|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 209612 : 217432 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 229404 : 244135 18 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 414767 : 469645 56 Streptococcus_phage(28.57%) tRNA,holin,bacteriocin,protease NA
DBSCAN-SWA_4 1032497 : 1040809 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_5 1109947 : 1118990 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1244758 : 1326246 80 Staphylococcus_phage(93.55%) transposase,tRNA,bacteriocin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage