Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP012642 Massilia sp. WG5 plasmid unnamed 2, complete sequence 0 crisprs NA 0 0 0 0
CP012641 Massilia sp. WG5 plasmid unnamed 1, complete sequence 0 crisprs PrimPol 0 0 1 0
CP012640 Massilia sp. WG5, complete sequence 1 crisprs DEDDh,csa3,DinG,cas3,RT,WYL 3 12 3 0

Results visualization

1. CP012641
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13472 : 79735 55 Yellowstone_lake_phycodnavirus(22.22%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP012640
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP012640_1 1239493-1239592 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 CP012640.2 129574-129596 1 0.957
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 CP012640.2 5458614-5458633 1 0.95
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 CP012640.2 1849003-1849022 2 0.9
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 CP012640.2 3509908-3509927 2 0.9
CP012640_4 4.6|4083664|20|CP012640|CRISPRCasFinder 4083664-4083683 20 CP012640.2 5873635-5873654 2 0.9

1. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to position: 129574-129596, mismatch: 1, identity: 0.957

accagcggcacctcgggcagcgg	CRISPR spacer
accaccggcacctcgggcagcgg	Protospacer
**** ******************

2. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to position: 5458614-5458633, mismatch: 1, identity: 0.95

tcgtcgggcagcagcggcag	CRISPR spacer
tcgtcggccagcagcggcag	Protospacer
******* ************

3. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to position: 1849003-1849022, mismatch: 2, identity: 0.9

tcgtcgggcagcagcggcag	CRISPR spacer
tcgccgggcggcagcggcag	Protospacer
***.*****.**********

4. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to position: 3509908-3509927, mismatch: 2, identity: 0.9

tcgtcgggcagcagcggcag	CRISPR spacer
tcgtcgtgcagcagctgcag	Protospacer
****** ******** ****

5. spacer 4.6|4083664|20|CP012640|CRISPRCasFinder matches to position: 5873635-5873654, mismatch: 2, identity: 0.9

tcgtccggcaccagcggcat	CRISPR spacer
tcgtccggccccagctgcat	Protospacer
********* ***** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 54713-54732 0 1.0
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 246239-246258 0 1.0
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 14596-14615 0 1.0
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 661209-661228 1 0.95
CP012640_4 4.4|4083535|20|CP012640|CRISPRCasFinder 4083535-4083554 20 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 353244-353263 1 0.95
CP012640_4 4.6|4083664|20|CP012640|CRISPRCasFinder 4083664-4083683 20 LR743523 Xylella phage Usme genome assembly, chromosome: 1 3996-4015 1 0.95
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_AP018666 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence 63853-63875 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 351858-351880 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 721145-721167 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 MN813693 Mycobacterium phage Imvubu, complete genome 44054-44076 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP023451 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence 191305-191327 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 368394-368416 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 450768-450790 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 9304-9326 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 567210-567232 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 613882-613904 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 466552-466574 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 201711-201733 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 523315-523337 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 208226-208248 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 226157-226179 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 572600-572622 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP026567 Pseudomonas avellanae strain R2leaf plasmid p5_tig9, complete sequence 4636-4658 2 0.913
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 821307-821329 3 0.87
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1408698-1408720 3 0.87
CP012640_4 4.3|4083481|23|CP012640|CRISPRCasFinder 4083481-4083503 23 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 213406-213428 3 0.87
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 MH744423 Mycobacterium phage Saguaro, complete genome 35283-35311 4 0.862
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 185742-185768 4 0.852
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2276802-2276828 4 0.852
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 258709-258735 4 0.852
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 109628-109654 4 0.852
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 432941-432967 4 0.852
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 25322-25348 4 0.852
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2715599-2715625 4 0.852
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NC_026603 Mycobacterium phage Keshu, complete genome 38815-38841 4 0.852
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 13221-13247 4 0.852
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 91226-91252 4 0.852
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 25322-25348 4 0.852
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP015586 Roseomonas gilardii strain U14-5 plasmid 2, complete sequence 46724-46755 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 781915-781946 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 279561-279592 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1968796-1968827 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 641450-641481 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 641450-641481 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 631691-631722 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 641451-641482 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 631691-631722 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 631691-631722 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 631691-631722 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 631691-631722 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1394995-1395026 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 628886-628917 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 631678-631709 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 641447-641478 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 631693-631724 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 641453-641484 5 0.844
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 633148-633176 5 0.828
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1750610-1750638 5 0.828
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 212406-212434 5 0.828
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 368399-368425 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 450759-450785 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 9295-9321 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 567201-567227 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 721136-721162 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 226162-226188 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 281674-281700 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 613873-613899 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 466543-466569 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 201702-201728 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 523306-523332 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 208217-208243 5 0.815
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 572605-572631 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 13221-13247 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2715599-2715625 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 984536-984562 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1112840-1112866 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NZ_CP033227 Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence 91226-91252 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1003522-1003548 5 0.815
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 NC_026603 Mycobacterium phage Keshu, complete genome 38815-38841 5 0.815
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 105464-105490 5 0.815
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 473637-473665 6 0.793
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 670137-670165 6 0.793
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 659523-659551 6 0.793
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1462235-1462263 6 0.793
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 612197-612225 6 0.793
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 38033-38061 6 0.793
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 121584-121610 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 142265-142291 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_LR134458 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence 9062-9088 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 122638-122664 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 142265-142291 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 142274-142300 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 142292-142318 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 142264-142290 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 236200-236226 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 121598-121624 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 3845-3871 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 812415-812441 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 121597-121623 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 121595-121621 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 MN693996 Marine virus AFVG_250M857, complete genome 9490-9516 6 0.778
CP012640_4 4.9|4083472|27|CP012640|CRT 4083472-4083498 27 MN693733 Marine virus AFVG_250M308, complete genome 9187-9213 6 0.778
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 147319-147345 6 0.778
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 641119-641148 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 662744-662773 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1946298-1946327 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 929255-929284 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 444220-444249 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 409333-409362 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1098676-1098705 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 2054986-2055015 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1987531-1987560 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 2009105-2009134 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 2052335-2052364 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 149120-149149 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1702723-1702752 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1989796-1989825 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 583733-583762 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1025680-1025709 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 219085-219114 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 2060665-2060694 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1770290-1770319 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1995347-1995376 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 2123928-2123957 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1991037-1991066 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 2063787-2063816 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1926658-1926687 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1990856-1990885 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 2072135-2072164 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 2063712-2063741 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1964557-1964586 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 2042798-2042827 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 2064495-2064524 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1970332-1970361 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1964870-1964899 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 2042798-2042827 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 2064615-2064644 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1964558-1964587 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1970980-1971009 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1963761-1963790 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 2042798-2042827 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 2042798-2042827 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 2042798-2042827 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 2064590-2064619 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 2123986-2124015 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 2064621-2064650 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1970356-1970385 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1978235-1978264 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1958866-1958895 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 2022944-2022973 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 2051065-2051094 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 2040113-2040142 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 2064621-2064650 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1970356-1970385 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1964869-1964898 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1998506-1998535 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 2063577-2063606 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1970356-1970385 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1970356-1970385 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 2064611-2064640 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 2042803-2042832 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 2122934-2122963 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 2064643-2064672 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 2064444-2064473 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 2122934-2122963 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 49377-49406 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 296724-296753 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 358939-358968 6 0.8
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 62941-62970 6 0.8
CP012640_5 5.1|5439436|30|CP012640|CRISPRCasFinder 5439436-5439465 30 EU307295 Burkholderia phage Bups phi1 clone 5 partial sequence 338-367 6 0.8
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1594358-1594389 7 0.781
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4915647-4915675 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 39319-39347 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 33169-33197 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 96491-96519 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 199617-199645 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 317464-317492 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 CP047034 Rhodobacter sphaeroides strain DSM 158 plasmid pB, complete sequence 61468-61496 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP015291 Rhodobacter sphaeroides strain MBTLJ-20 plasmid c, complete sequence 75796-75824 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP047040 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pB, complete sequence 61417-61445 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 145497-145525 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP051471 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10B, complete sequence 30277-30305 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP030274 Rhodobacter sphaeroides 2.4.1 plasmid pB, complete sequence 51745-51773 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1087822-1087850 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 323989-324017 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP015215 Rhodobacter sphaeroides strain MBTLJ-13 plasmid d, complete sequence 15558-15586 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 162691-162719 7 0.759
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 548218-548246 7 0.759
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 CP054928 Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence 41022-41048 7 0.741
CP012640_4 4.10|4083520|27|CP012640|CRT 4083520-4083546 27 MH067976 Arthrobacter sp. strain ANT_H58 plasmid pA58H3, complete sequence 28398-28424 7 0.741
CP012640_4 4.12|4083607|27|CP012640|CRT 4083607-4083633 27 MH067976 Arthrobacter sp. strain ANT_H58 plasmid pA58H3, complete sequence 28398-28424 7 0.741
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_AP017921 Thermus thermophilus strain TMY plasmid pTMY, complete sequence 4599-4628 7 0.767
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2715590-2715619 7 0.767
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP029174 Methylobacterium sp. DM1 plasmid pLVM1, complete sequence 155384-155413 7 0.767
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP019065 Rahnella sp. ERMR1:05 plasmid unnamed3, complete sequence 52482-52511 7 0.767
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 2481-2510 7 0.767
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 298416-298445 7 0.767
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 208128-208163 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 251976-252011 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 777810-777845 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 923802-923837 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 742512-742547 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 923809-923844 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1227291-1227326 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 732447-732482 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 798147-798182 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 798170-798205 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 798170-798205 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 798170-798205 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 798170-798205 8 0.778
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 798170-798205 8 0.778
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 926283-926314 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1350681-1350712 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1321166-1321197 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP020041 Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence 20957-20988 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2463053-2463084 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP015420 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence 88769-88800 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1102642-1102673 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1947363-1947394 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 105168-105199 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 402133-402164 8 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 660590-660621 8 0.75
CP012640_4 4.2|4083421|29|CP012640|CRISPRCasFinder 4083421-4083449 29 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 44692-44720 8 0.724
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_016591 Burkholderia sp. YI23 plasmid byi_2p, complete sequence 216977-217006 8 0.733
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 40749-40778 8 0.733
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 87865-87894 8 0.733
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 89606-89635 8 0.733
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1812998-1813033 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1199343-1199378 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 976495-976530 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1203258-1203293 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1796034-1796069 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1339591-1339626 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1157524-1157559 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1339558-1339593 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1338363-1338398 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1338400-1338435 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1338400-1338435 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1132470-1132505 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1338389-1338424 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1246663-1246698 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1338389-1338424 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 901524-901559 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1339556-1339591 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1338400-1338435 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1160449-1160484 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1338411-1338446 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1338389-1338424 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1160449-1160484 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1072536-1072571 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1194847-1194882 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 873881-873916 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 828435-828470 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 978302-978337 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1472500-1472535 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 901090-901125 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1498026-1498061 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1194983-1195018 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 923763-923798 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1094701-1094736 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 691178-691213 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1247661-1247696 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 817911-817946 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 905436-905471 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 626365-626400 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 831961-831996 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 977399-977434 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 830563-830598 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1194564-1194599 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 978294-978329 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 977650-977685 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 978285-978320 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 827776-827811 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 905425-905460 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 893776-893811 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 938493-938528 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1194509-1194544 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 920600-920635 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 893776-893811 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 938493-938528 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 683140-683175 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 893776-893811 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1072634-1072669 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 893780-893815 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 938493-938528 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 938493-938528 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 938493-938528 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 834299-834334 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1072629-1072664 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 814991-815026 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 869226-869261 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 906108-906143 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 893776-893811 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 938495-938530 9 0.75
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1072613-1072648 9 0.75
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 468882-468913 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 962182-962213 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NZ_CP031226 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence 879884-879915 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 186170-186201 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 150586-150617 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 210242-210273 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 693844-693875 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 478495-478526 9 0.719
CP012640_4 4.1|4083358|32|CP012640|CRISPRCasFinder 4083358-4083389 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 482423-482454 9 0.719
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 99839-99868 9 0.7
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP039426 Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence 61649-61678 9 0.7
CP012640_4 4.13|4083655|30|CP012640|CRT 4083655-4083684 30 NZ_CP039431 Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence 61650-61679 9 0.7
CP012640_5 5.2|5439490|30|CP012640|CRISPRCasFinder 5439490-5439519 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1173256-1173285 9 0.7
CP012640_3 3.1|3175186|36|CP012640|CRISPRCasFinder 3175186-3175221 36 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 920554-920589 10 0.722

1. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtcgggcagcagcggcag	CRISPR spacer
tcgtcgggcagcagcggcag	Protospacer
********************

2. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtcgggcagcagcggcag	CRISPR spacer
tcgtcgggcagcagcggcag	Protospacer
********************

3. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtcgggcagcagcggcag	CRISPR spacer
tcgtcgggcagcagcggcag	Protospacer
********************

4. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.95

tcgtcgggcagcagcggcag	CRISPR spacer
acgtcgggcagcagcggcag	Protospacer
 *******************

5. spacer 4.4|4083535|20|CP012640|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 1, identity: 0.95

tcgtcgggcagcagcggcag	CRISPR spacer
acgtcgggcagcagcggcag	Protospacer
 *******************

6. spacer 4.6|4083664|20|CP012640|CRISPRCasFinder matches to LR743523 (Xylella phage Usme genome assembly, chromosome: 1) position: , mismatch: 1, identity: 0.95

tcgtccggcaccagcggcat	CRISPR spacer
gcgtccggcaccagcggcat	Protospacer
 *******************

7. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_AP018666 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accagcgccacctcgggcagcgt	Protospacer
******* ************** 

8. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
gccaccggcacctcgggcagcgg	Protospacer
.*** ******************

9. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accagcggcacctcggccagcgt	Protospacer
**************** ***** 

10. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
tccagcggcacctcgggcagcag	Protospacer
 ********************.*

11. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accagcgccacctcgggcagcgt	Protospacer
******* ************** 

12. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accagcggcacctcggccagcgt	Protospacer
**************** ***** 

13. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

14. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

15. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

16. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

17. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

18. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

19. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

20. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

21. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

22. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

23. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP026567 (Pseudomonas avellanae strain R2leaf plasmid p5_tig9, complete sequence) position: , mismatch: 2, identity: 0.913

accagcggcacctcgggcagcgg	CRISPR spacer
accggcggcacctcgggcatcgg	Protospacer
***.*************** ***

24. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.87

accagcggcacctcgggcagcgg	CRISPR spacer
accagcggcaccgcgggcagcac	Protospacer
************ ********. 

25. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 3, identity: 0.87

accagcggcacctcgggcagcgg	CRISPR spacer
accagcggcaccgcgggcagcac	Protospacer
************ ********. 

26. spacer 4.3|4083481|23|CP012640|CRISPRCasFinder matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.87

accagcggcacctcgggcagcgg	CRISPR spacer
cccagcgtcacctcgggcagcgc	Protospacer
 ****** ************** 

27. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 4, identity: 0.862

atgggc--agcggcagcggctcctcgggctc	CRISPR spacer
--gggccgagcggcagcggctcctggggctg	Protospacer
  ****  **************** ***** 

28. spacer 4.9|4083472|27|CP012640|CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 4, identity: 0.852

agcatgggcaccagcggcacctcgggc	CRISPR spacer
atcatcggcaccagcggcatctcgggt	Protospacer
* *** *************.******.

29. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcatcggcgccagcggcacctcgttc	Protospacer
***** ***.**************  *

30. spacer 4.9|4083472|27|CP012640|CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 4, identity: 0.852

agcatgggcaccagcggcacc-tcgggc	CRISPR spacer
agcatgggcaccaccggcaccatcatg-	Protospacer
************* ******* **. * 

31. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.852

agcatgggcaccagcggca---cctcgggc	CRISPR spacer
agcatgggcatcagcggcaccgcctcg---	Protospacer
**********.********   *****   

32. spacer 4.10|4083520|27|CP012640|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcagc	CRISPR spacer
accggcgcctcgcgttcgtcgggcgcc	Protospacer
******.***** ***********. *

33. spacer 4.10|4083520|27|CP012640|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcagc	CRISPR spacer
accagcacctcgggttcgtcgaacatc	Protospacer
***.*****************..** *

34. spacer 4.12|4083607|27|CP012640|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcacc	CRISPR spacer
ccgtgcgcctcgggttcgtcgggcacc	Protospacer
 *  **.********************

35. spacer 4.12|4083607|27|CP012640|CRT matches to NC_026603 (Mycobacterium phage Keshu, complete genome) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcacc	CRISPR spacer
gacggcacctcggcgtcgtcgggcacc	Protospacer
. ***********  ************

36. spacer 4.12|4083607|27|CP012640|CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcacc	CRISPR spacer
agcggcacctccggttcgtccggcact	Protospacer
* ********* ******** *****.

37. spacer 4.12|4083607|27|CP012640|CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcacc	CRISPR spacer
agcggcacctccggttcgtccggcact	Protospacer
* ********* ******** *****.

38. spacer 4.12|4083607|27|CP012640|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

accggcacctcgggttcgtcgggcacc	CRISPR spacer
accagcacctcgggttcgtcgaacatc	Protospacer
***.*****************..**.*

39. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP015586 (Roseomonas gilardii strain U14-5 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.844

agcac-cggatcgagcagcagcatgggcggcac	CRISPR spacer
-ccacgctgatcgagcagcatcacgggcggcac	Protospacer
  *** * ************ **.*********

40. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

41. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

42. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

43. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

44. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

45. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

46. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

47. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

48. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

49. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

50. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

51. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

52. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

53. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

54. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

55. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

56. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

57. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

58. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

59. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

60. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

61. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

62. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.844

agcaccggatcgagcagcagcatgggcggcac-	CRISPR spacer
agcaccagatcgagcagcagcac-ggcggcctg	Protospacer
******.***************. ****** . 

63. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
tcgggcagatgcagcggctcctcgggcgc	Protospacer
 .******  ***************** *

64. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.828

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
atctgcagcggcagcgcctcctcgggcgt	Protospacer
**  ************ ********** .

65. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 5, identity: 0.828

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
aacggcagcggcagcggctccacgcgcac	Protospacer
*  ****************** ** ** *

66. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tccatcagcaccagcggcacctcggcc	Protospacer
  *** .****************** *

67. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

68. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

69. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

70. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tccatcagcaccagcggcacctcggcc	Protospacer
  *** .****************** *

71. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

72. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
cgctgcggcaccagcggcacctggggc	Protospacer
 **   **************** ****

73. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

74. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

75. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

76. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

77. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

78. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815

agcatgggcaccagcggcacctcgggc	CRISPR spacer
gccctggtcaccggcggcacctcgggc	Protospacer
. * *** ****.**************

79. spacer 4.10|4083520|27|CP012640|CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
agcggcacctccggttcgtccggcact	Protospacer
* ********* ******** **** .

80. spacer 4.10|4083520|27|CP012640|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
ccgtgcgcctcgggttcgtcgggcacc	Protospacer
 *  **.****************** *

81. spacer 4.10|4083520|27|CP012640|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
ccgagcgcctcaggttcgtcgggcagc	Protospacer
 * .**.****.***************

82. spacer 4.10|4083520|27|CP012640|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
gcggcgacctcggcttcgtcgggcagc	Protospacer
.* *  ******* *************

83. spacer 4.10|4083520|27|CP012640|CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
agcggcacctccggttcgtccggcact	Protospacer
* ********* ******** **** .

84. spacer 4.10|4083520|27|CP012640|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
gcaagcacctcgggatcgtcgcgcagc	Protospacer
.* .********** ****** *****

85. spacer 4.10|4083520|27|CP012640|CRT matches to NC_026603 (Mycobacterium phage Keshu, complete genome) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcagc	CRISPR spacer
gacggcacctcggcgtcgtcgggcacc	Protospacer
. ***********  ********** *

86. spacer 4.12|4083607|27|CP012640|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.815

accggcacctcgggttcgtcgggcacc	CRISPR spacer
cgcagcacctcgggttcgtcgtgctcc	Protospacer
  *.***************** ** **

87. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
accggccgcggcagcggctcctccggcgg	Protospacer
*. *** **************** ***  

88. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
accggccgcggcagcggctcctccggcgg	Protospacer
*. *** **************** ***  

89. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
accggccgcggcagcggctcctccggcgg	Protospacer
*. *** **************** ***  

90. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
accggccgcggcagcggctcctccggcgg	Protospacer
*. *** **************** ***  

91. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
accggccgcggcagcggctcctccggcgg	Protospacer
*. *** **************** ***  

92. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 6, identity: 0.793

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
tcgcgcagcgacagcggctcctcgcgcac	Protospacer
 .* ******.************* ** *

93. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

94. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

95. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
ggcatgggcaccatcggcatctcgtcg	Protospacer
.************ *****.****   

96. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

97. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

98. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

99. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

100. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

101. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcatcggcaccagcggcaccgccctg	Protospacer
***** *************** *    

102. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

103. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcatcggcaccagcggcaccgccctg	Protospacer
***** *************** *    

104. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcatcggcaccagcggcaccgccctg	Protospacer
***** *************** *    

105. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

106. spacer 4.9|4083472|27|CP012640|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
tgcatgggcaccagcagcaccgcgacg	Protospacer
 **************.***** **.  

107. spacer 4.9|4083472|27|CP012640|CRT matches to MN693996 (Marine virus AFVG_250M857, complete genome) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcaggggcaccagcggcaccggcagg	Protospacer
**** ****************   .* 

108. spacer 4.9|4083472|27|CP012640|CRT matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 6, identity: 0.778

agcatgggcaccagcggcacctcgggc	CRISPR spacer
agcaggggcaccagcggcaccggcagg	Protospacer
**** ****************   .* 

109. spacer 4.12|4083607|27|CP012640|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 6, identity: 0.778

accggcacctcgggttcgtcgggcacc	CRISPR spacer
attttcacctcgggttcgacgggcacg	Protospacer
*..  ************* ******* 

110. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

111. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

112. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

113. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcacgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

114. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

115. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

116. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

117. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

118. spacer 4.13|4083655|30|CP012640|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

119. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

120. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

121. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

122. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

123. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

124. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

125. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

126. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

127. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

128. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

129. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

130. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

131. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

132. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

133. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

134. spacer 4.13|4083655|30|CP012640|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

135. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

136. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

137. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

138. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

139. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

140. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

141. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

142. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

143. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

144. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

145. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

146. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

147. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

148. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

149. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

150. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

151. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

152. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

153. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

154. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

155. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

156. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

157. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

158. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

159. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

160. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

161. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

162. spacer 4.13|4083655|30|CP012640|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

163. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

164. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

165. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

166. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

167. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

168. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

169. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

170. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

171. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggcgcgggctcgaccggcgccagcggcatc	Protospacer
. * ******** *****.********** 

172. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
atccacggctcgtccggcaccaccggcaag	Protospacer
*.*.  **************** ***** *

173. spacer 4.13|4083655|30|CP012640|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
atccacggctcgtccggcaccaccggcaag	Protospacer
*.*.  **************** ***** *

174. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
atccacggctcgtccggcaccaccggcaag	Protospacer
*.*.  **************** ***** *

175. spacer 4.13|4083655|30|CP012640|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 6, identity: 0.8

acctcgggctcgtccggca---ccagcggcatg	CRISPR spacer
acctcgggctcgaccggcacccccaaaggc---	Protospacer
************ ******   ***. ***   

176. spacer 5.1|5439436|30|CP012640|CRISPRCasFinder matches to EU307295 (Burkholderia phage Bups phi1 clone 5 partial sequence) position: , mismatch: 6, identity: 0.8

tgctgacctgcggatcgccgtagtaattga	CRISPR spacer
agctcatctgcggatcgccgtagtagacga	Protospacer
 *** *.******************. .**

177. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.781

-agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
atgcatc-gatcgagcagcagcgtgagcggcgg	Protospacer
  ***.* **************.**.*****. 

178. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
taccactgcggcagcggctgctcgggctc	Protospacer
    .* ************ *********

179. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
atgggcagcggctgcggctccttctgggt	Protospacer
************ *********.  *  .

180. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
ggccgcagcggcagcggctcgtcggggtg	Protospacer
.   **************** ***** * 

181. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
atgggcagcggctgcggctccttctgggt	Protospacer
************ *********.  *  .

182. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
cggggcagcggcagcggatcctccgaccg	Protospacer
  *************** ***** *.*. 

183. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
ccgggcagcaccagcggctcctcggcggc	Protospacer
 .*******. **************   *

184. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to CP047034 (Rhodobacter sphaeroides strain DSM 158 plasmid pB, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

185. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP015291 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid c, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

186. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP047040 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pB, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

187. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gagggcagcggcggcggctcctccgccat	Protospacer
. **********.********** * * .

188. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP051471 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10B, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

189. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP030274 (Rhodobacter sphaeroides 2.4.1 plasmid pB, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

190. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
ctgccgcgcggcagcggctcctcgcgctt	Protospacer
 **    ***************** ***.

191. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

192. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP015215 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid d, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
gcgggcagcggcaccggcacctcggtggc	Protospacer
..*********** **** ******   *

193. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
tagaccagcggcagcggcacctcggggtt	Protospacer
  *. ************* ******* *.

194. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.759

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
ccgggcagccgcagctgctcctcggccca	Protospacer
 .******* ***** ********* *. 

195. spacer 4.10|4083520|27|CP012640|CRT matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.741

accggcacctcgggttcgtcgggcagc	CRISPR spacer
ggccctgcctcgggttcgtcgggcagg	Protospacer
. *  ..******************* 

196. spacer 4.10|4083520|27|CP012640|CRT matches to MH067976 (Arthrobacter sp. strain ANT_H58 plasmid pA58H3, complete sequence) position: , mismatch: 7, identity: 0.741

accggcacctcgggttcgtcgggcagc	CRISPR spacer
tggagcacctcgggtacgtcgggcaag	Protospacer
   .*********** *********. 

197. spacer 4.12|4083607|27|CP012640|CRT matches to MH067976 (Arthrobacter sp. strain ANT_H58 plasmid pA58H3, complete sequence) position: , mismatch: 7, identity: 0.741

accggcacctcgggttcgtcgggcacc	CRISPR spacer
tggagcacctcgggtacgtcgggcaag	Protospacer
   .*********** *********  

198. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_AP017921 (Thermus thermophilus strain TMY plasmid pTMY, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
acctcgggctcgtcctccaccagcaagagc	Protospacer
***************  *******.. *  

199. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
gcctcgggttcgtcgggcaccagcgccgcc	Protospacer
.*******.***** ********** *.. 

200. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP029174 (Methylobacterium sp. DM1 plasmid pLVM1, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
agggccggctcggccggcaccagcgtcatc	Protospacer
*   * ****** ************ *** 

201. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP019065 (Rahnella sp. ERMR1:05 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
atcacgggatcgtccggcagcagcggctgc	Protospacer
*.* **** ********** *******   

202. spacer 4.13|4083655|30|CP012640|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
acggtgcgctcgtccggcacctgcggcact	Protospacer
**  .* ************** ******. 

203. spacer 4.13|4083655|30|CP012640|CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.767

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ggctcggcctcgtccagcaccagcgcgatc	Protospacer
. ***** *******.*********  ** 

204. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

205. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

206. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

207. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccgccaggcgccccag	Protospacer
 ***********.*************** . **   

208. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

209. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccgccaggcgccccag	Protospacer
 ***********.*************** . **   

210. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

211. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

212. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

213. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

214. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

215. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

216. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

217. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.778

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccgccaggcgccccag	Protospacer
 ************** ************ . **   

218. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

219. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

220. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

221. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acctgcacgtcgtgcagcagcatgcgcggcac	Protospacer
* *  *. .*** *********** *******

222. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccg----gatcgagcagcagcatgggcggcac	CRISPR spacer
----ccgtggtcgtcgagaagcagcatcggcggcac	Protospacer
    ***     .***** ******** ********

223. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccg-gatcgagcagcagcatgggcggcac	CRISPR spacer
-tcgctgtcgtcgagcggcagcatcggcggcac	Protospacer
  *.*.*  .******.******* ********

224. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

225. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

226. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 8, identity: 0.75

agcaccg-gatcgagcagcagcatgggcggcac	CRISPR spacer
-tcgctgtcgtcgagcggcagcatcggcggcac	Protospacer
  *.*.*  .******.******* ********

227. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

228. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgatcctgatcgagcagcaggatgggccgtcc	Protospacer
 *  ** ************* ****** *. *

229. spacer 4.2|4083421|29|CP012640|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 8, identity: 0.724

atgggcagcggcagcggctcctcgggctc	CRISPR spacer
tccggcagcggcagcgggtccttggggag	Protospacer
 . ************** ****.***   

230. spacer 4.13|4083655|30|CP012640|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 8, identity: 0.733

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
acctcgggctcggccggcatcagctcggcc	Protospacer
************ ******.****   .. 

231. spacer 4.13|4083655|30|CP012640|CRT matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 8, identity: 0.733

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
tactcgggctcgtccggcacctgcacgccg	Protospacer
  ******************* **.   .*

232. spacer 4.13|4083655|30|CP012640|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.733

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
tggtcgggctcgtccagcaccagcaggtcg	Protospacer
   ************.********.*  .*

233. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
aaaactggctcgaccggcaccagcggccat	Protospacer
*   * ****** **************   

234. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

235. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

236. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

237. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcatccgccaggcgccccag	Protospacer
 ***********.*****.********* . **   

238. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

239. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

240. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

241. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

242. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

243. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

244. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

245. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

246. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

247. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

248. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

249. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

250. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

251. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

252. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

253. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

254. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

255. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

256. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

257. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

258. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

259. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

260. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

261. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

262. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

263. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaacgcctccaccaggcgccccag	Protospacer
 ***************** ***.***** . **   

264. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

265. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

266. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

267. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcatccgccaggcgccccag	Protospacer
 ***********.*****.********* . **   

268. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

269. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

270. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

271. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

272. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

273. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

274. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

275. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcatccgccaggcgccccag	Protospacer
 ***********.*****.********* . **   

276. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

277. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

278. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

279. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

280. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

281. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

282. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

283. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

284. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcgtccaccaggcgccccag	Protospacer
 ***********.*********.***** . **   

285. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

286. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

287. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccagaaacgcatccgccaggcgccccag	Protospacer
 ***********.*****.********* . **   

288. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

289. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

290. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

291. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

292. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

293. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

294. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

295. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

296. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

297. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

298. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

299. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

300. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccaggcgccccag	Protospacer
 ************** ******.***** . **   

301. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaatgcgtccaccaggtgccccag	Protospacer
 **************.******.***** . **   

302. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
cgttccggatcgagccgcagcacgggcatcga	Protospacer
 *. *********** ******.****. *. 

303. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

304. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
caagacgcttcgttcagcagcatgggcggcac	Protospacer
 . . **  ***  ******************

305. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

306. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

307. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

308. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

309. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

310. spacer 4.1|4083358|32|CP012640|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

agcaccggatcgagcagcagcatgggcggcac	CRISPR spacer
acagccgggtcgagccgcagcatgggcacacc	Protospacer
*  .****.****** ***********.   *

311. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 9, identity: 0.7

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
gaggtgggctcgtccgccaccagcagcaat	Protospacer
.   .*********** *******.***  

312. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP039426 (Citricoccus sp. SGAir0253 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ttctcggcctcgtccggcagcagcgcggcc	Protospacer
 .***** *********** *****  .. 

313. spacer 4.13|4083655|30|CP012640|CRT matches to NZ_CP039431 (Citricoccus sp. SGAir0453 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7

acctcgggctcgtccggcaccagcggcatg	CRISPR spacer
ttctcggcctcgtccggcagcagcgcggcc	Protospacer
 .***** *********** *****  .. 

314. spacer 5.2|5439490|30|CP012640|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.7

tgctcaggctgtcgcgtacccacagggtcg	CRISPR spacer
acgccgcgctgtcgcgtaccgacagggtga	Protospacer
   .*. ************* ******* .

315. spacer 3.1|3175186|36|CP012640|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.722

ctgcagcgccaggaacgcgtccgccaggaagccgct	CRISPR spacer
gtgcagcgccaggaaggcgtccaccagacgccccag	Protospacer
 ************** ******.****. . **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17333 : 36315 30 Pseudomonas_phage(21.43%) terminase NA
DBSCAN-SWA_2 1026154 : 1030481 6 uncultured_Caudovirales_phage(83.33%) NA NA
DBSCAN-SWA_3 4274547 : 4290220 12 Bacillus_phage(22.22%) integrase,tRNA attL 4264047:4264064|attR 4283209:4283226
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage