Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP014063 Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence 0 crisprs csa3 0 0 3 0
CP014064 Staphylococcus aureus strain FDAARGOS_159 chromosome, complete genome 8 crisprs DEDDh,DinG,cas3,csa3,RT,WYL 9 2 12 2

Results visualization

1. CP014064
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_1 31264-31345 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_2 1248229-1248310 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_3 1377485-1377565 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_4 1498845-1498925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_5 2115344-2115428 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_6 2353103-2353204 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_7 2767580-2767658 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014064_8 2773035-2773304 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP014064_2 2.1|1248253|34|CP014064|CRISPRCasFinder 1248253-1248286 34 CP014064.2 2767579-2767612 0 1.0
CP014064_5 5.1|2115370|33|CP014064|CRISPRCasFinder 2115370-2115402 33 CP014064.2 550737-550769 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 31337-31358 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 550640-550661 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 639191-639212 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 820721-820742 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 835255-835276 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 1147067-1147088 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 2115331-2115352 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 2238467-2238488 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 2238577-2238598 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 2601099-2601120 0 1.0
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 2725625-2725646 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 31337-31358 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 550640-550661 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 639191-639212 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 820721-820742 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 835255-835276 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 1147067-1147088 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 2115331-2115352 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 2238467-2238488 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 2238577-2238598 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 2601099-2601120 0 1.0
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 2725625-2725646 0 1.0
CP014064_1 1.1|31288|34|CP014064|CRISPRCasFinder 31288-31321 34 CP014064.2 550736-550769 1 0.971
CP014064_2 2.1|1248253|34|CP014064|CRISPRCasFinder 1248253-1248286 34 CP014064.2 337307-337340 1 0.971
CP014064_2 2.1|1248253|34|CP014064|CRISPRCasFinder 1248253-1248286 34 CP014064.2 940610-940643 1 0.971
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2780323-2780353 1 0.968
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2780379-2780409 1 0.968
CP014064_7 7.1|2767604|31|CP014064|CRISPRCasFinder 2767604-2767634 31 CP014064.2 2238542-2238572 1 0.968
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 144827-144848 1 0.955
CP014064_8 8.1|2773071|22|CP014064|CRT 2773071-2773092 22 CP014064.2 854982-855003 1 0.955
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 550756-550778 1 0.957
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 1147125-1147147 1 0.957
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 1486496-1486518 1 0.957
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 2726575-2726597 1 0.957
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 2726909-2726931 1 0.957
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 144827-144848 1 0.955
CP014064_8 8.3|2773188|22|CP014064|CRT 2773188-2773209 22 CP014064.2 854982-855003 1 0.955
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 550756-550778 1 0.957
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 1147125-1147147 1 0.957
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 1486496-1486518 1 0.957
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 2726575-2726597 1 0.957
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 2726909-2726931 1 0.957
CP014064_2 2.1|1248253|34|CP014064|CRISPRCasFinder 1248253-1248286 34 CP014064.2 555110-555143 2 0.941
CP014064_2 2.1|1248253|34|CP014064|CRISPRCasFinder 1248253-1248286 34 CP014064.2 1939000-1939033 2 0.941
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 31600-31630 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 240318-240348 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 343076-343106 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 550695-550725 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 639127-639157 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 639243-639273 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 835309-835339 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 1486549-1486579 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 1663700-1663730 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2016683-2016713 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2314365-2314395 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2601154-2601184 2 0.935
CP014064_4 4.1|1498870|31|CP014064|CRISPRCasFinder 1498870-1498900 31 CP014064.2 2780435-2780465 2 0.935
CP014064_5 5.1|2115370|33|CP014064|CRISPRCasFinder 2115370-2115402 33 CP014064.2 639083-639115 2 0.939
CP014064_7 7.1|2767604|31|CP014064|CRISPRCasFinder 2767604-2767634 31 CP014064.2 855127-855157 2 0.935
CP014064_7 7.1|2767604|31|CP014064|CRISPRCasFinder 2767604-2767634 31 CP014064.2 2238487-2238517 2 0.935
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 639074-639096 2 0.913
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 CP014064.2 1248310-1248332 2 0.913
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 639074-639096 2 0.913
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 CP014064.2 1248310-1248332 2 0.913

1. spacer 2.1|1248253|34|CP014064|CRISPRCasFinder matches to position: 2767579-2767612, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

2. spacer 5.1|2115370|33|CP014064|CRISPRCasFinder matches to position: 550737-550769, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

3. spacer 8.1|2773071|22|CP014064|CRT matches to position: 31337-31358, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 8.1|2773071|22|CP014064|CRT matches to position: 550640-550661, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 8.1|2773071|22|CP014064|CRT matches to position: 639191-639212, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 8.1|2773071|22|CP014064|CRT matches to position: 820721-820742, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 8.1|2773071|22|CP014064|CRT matches to position: 835255-835276, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 8.1|2773071|22|CP014064|CRT matches to position: 1147067-1147088, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 8.1|2773071|22|CP014064|CRT matches to position: 2115331-2115352, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 8.1|2773071|22|CP014064|CRT matches to position: 2238467-2238488, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 8.1|2773071|22|CP014064|CRT matches to position: 2238577-2238598, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 8.1|2773071|22|CP014064|CRT matches to position: 2601099-2601120, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 8.1|2773071|22|CP014064|CRT matches to position: 2725625-2725646, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 8.3|2773188|22|CP014064|CRT matches to position: 31337-31358, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 8.3|2773188|22|CP014064|CRT matches to position: 550640-550661, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 8.3|2773188|22|CP014064|CRT matches to position: 639191-639212, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 8.3|2773188|22|CP014064|CRT matches to position: 820721-820742, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 8.3|2773188|22|CP014064|CRT matches to position: 835255-835276, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 8.3|2773188|22|CP014064|CRT matches to position: 1147067-1147088, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 8.3|2773188|22|CP014064|CRT matches to position: 2115331-2115352, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 8.3|2773188|22|CP014064|CRT matches to position: 2238467-2238488, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

22. spacer 8.3|2773188|22|CP014064|CRT matches to position: 2238577-2238598, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

23. spacer 8.3|2773188|22|CP014064|CRT matches to position: 2601099-2601120, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

24. spacer 8.3|2773188|22|CP014064|CRT matches to position: 2725625-2725646, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

25. spacer 1.1|31288|34|CP014064|CRISPRCasFinder matches to position: 550736-550769, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

26. spacer 2.1|1248253|34|CP014064|CRISPRCasFinder matches to position: 337307-337340, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatatcttttcgaaattctctgtgttgg	Protospacer
********* ************************

27. spacer 2.1|1248253|34|CP014064|CRISPRCasFinder matches to position: 940610-940643, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgtgttgg	Protospacer
*************************.********

28. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2780323-2780353, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

29. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2780379-2780409, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

30. spacer 7.1|2767604|31|CP014064|CRISPRCasFinder matches to position: 2238542-2238572, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgtattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
************************.******

31. spacer 8.1|2773071|22|CP014064|CRT matches to position: 144827-144848, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

32. spacer 8.1|2773071|22|CP014064|CRT matches to position: 854982-855003, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

33. spacer 8.2|2773129|23|CP014064|CRT matches to position: 550756-550778, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

34. spacer 8.2|2773129|23|CP014064|CRT matches to position: 1147125-1147147, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

35. spacer 8.2|2773129|23|CP014064|CRT matches to position: 1486496-1486518, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

36. spacer 8.2|2773129|23|CP014064|CRT matches to position: 2726575-2726597, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

37. spacer 8.2|2773129|23|CP014064|CRT matches to position: 2726909-2726931, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 8.3|2773188|22|CP014064|CRT matches to position: 144827-144848, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

39. spacer 8.3|2773188|22|CP014064|CRT matches to position: 854982-855003, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

40. spacer 8.4|2773246|23|CP014064|CRT matches to position: 550756-550778, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

41. spacer 8.4|2773246|23|CP014064|CRT matches to position: 1147125-1147147, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

42. spacer 8.4|2773246|23|CP014064|CRT matches to position: 1486496-1486518, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

43. spacer 8.4|2773246|23|CP014064|CRT matches to position: 2726575-2726597, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

44. spacer 8.4|2773246|23|CP014064|CRT matches to position: 2726909-2726931, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

45. spacer 2.1|1248253|34|CP014064|CRISPRCasFinder matches to position: 555110-555143, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

46. spacer 2.1|1248253|34|CP014064|CRISPRCasFinder matches to position: 1939000-1939033, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

47. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 31600-31630, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

48. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 240318-240348, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

49. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 343076-343106, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

50. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 550695-550725, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

51. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 639127-639157, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

52. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 639243-639273, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

53. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 835309-835339, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

54. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 1486549-1486579, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

55. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 1663700-1663730, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

56. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2016683-2016713, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

57. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2314365-2314395, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

58. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2601154-2601184, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

59. spacer 4.1|1498870|31|CP014064|CRISPRCasFinder matches to position: 2780435-2780465, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

60. spacer 5.1|2115370|33|CP014064|CRISPRCasFinder matches to position: 639083-639115, mismatch: 2, identity: 0.939

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tggaccccaacaaagagaaattgtattcccaat	Protospacer
***.******************* *********

61. spacer 7.1|2767604|31|CP014064|CRISPRCasFinder matches to position: 855127-855157, mismatch: 2, identity: 0.935

ctgtgttggggccccgccaacttgtattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** .******

62. spacer 7.1|2767604|31|CP014064|CRISPRCasFinder matches to position: 2238487-2238517, mismatch: 2, identity: 0.935

ctgtgttggggccccgccaacttgtattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
************************.***.**

63. spacer 8.2|2773129|23|CP014064|CRT matches to position: 639074-639096, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

64. spacer 8.2|2773129|23|CP014064|CRT matches to position: 1248310-1248332, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

65. spacer 8.4|2773246|23|CP014064|CRT matches to position: 639074-639096, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

66. spacer 8.4|2773246|23|CP014064|CRT matches to position: 1248310-1248332, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP014064_8 8.2|2773129|23|CP014064|CRT 2773129-2773151 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP014064_8 8.4|2773246|23|CP014064|CRT 2773246-2773268 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87

1. spacer 8.2|2773129|23|CP014064|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 8.2|2773129|23|CP014064|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 8.4|2773246|23|CP014064|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 8.4|2773246|23|CP014064|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 119 : 7864 10 Staphylococcus_phage(75.0%) terminase,coat NA
DBSCAN-SWA_2 39675 : 87408 72 Staphylococcus_phage(72.46%) head,plate,terminase,capsid,holin,integrase,tail,portal attL 35924:35940|attR 64676:64692
DBSCAN-SWA_3 170283 : 223407 55 Streptococcus_phage(28.57%) holin,bacteriocin,tRNA,protease NA
DBSCAN-SWA_4 241828 : 250301 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 870256 : 879299 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 993327 : 1066360 68 Staphylococcus_phage(95.74%) transposase,tRNA,protease NA
DBSCAN-SWA_7 1072561 : 1076808 6 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 1171098 : 1253193 108 Staphylococcus_phage(88.16%) head,protease,terminase,holin,capsid,integrase,tail,portal attL 1220157:1220174|attR 1244333:1244350
DBSCAN-SWA_9 2404447 : 2410188 8 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_10 2704703 : 2712524 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_11 2728556 : 2739192 12 uncultured_Caudovirales_phage(62.5%) NA NA
DBSCAN-SWA_12 2790149 : 2800969 14 Staphylococcus_phage(80.0%) integrase attL 2781218:2781233|attR 2800295:2800310
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP014064.2|AMG41685.1|1195723_1195900_-|hypothetical-protein 1195723_1195900_- 58 aa aa NA WHTH_GntR NA 1171098-1253193 yes
CP014064.2|AMG41686.1|1196142_1196241_-|hypothetical-protein 1196142_1196241_- 32 aa aa NA WHTH_GntR NA 1171098-1253193 yes
2. CP014063
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15431 13 Salmonella_phage(25.0%) NA NA
DBSCAN-SWA_2 19910 : 22724 6 Streptococcus_phage(50.0%) bacteriocin,integrase,transposase attL 11349:11370|attR 30188:30209
DBSCAN-SWA_3 26278 : 34940 8 Staphylococcus_phage(80.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage