Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP020451 Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,WYL,DinG 0 3 9 0

Results visualization

1. CP020451
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020451_1 43739-43813 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020451_3 771234-771334 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP020451_1 1.1|43764|25|CP020451|CRISPRCasFinder 43764-43788 25 MK448851 Streptococcus phage Javan14, complete genome 27770-27794 5 0.8
CP020451_4 4.1|2249698|34|CP020451|CRISPRCasFinder 2249698-2249731 34 NC_015417 Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence 19387-19420 10 0.706
CP020451_2 2.2|212282|34|CP020451|PILER-CR 212282-212315 34 MN693484 Marine virus AFVG_25M226, complete genome 950-983 11 0.676

1. spacer 1.1|43764|25|CP020451|CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 5, identity: 0.8

cctcgctttttcatttctgggctcg	CRISPR spacer
ataagctttttcatttctgggctag	Protospacer
 .  ******************* *

2. spacer 4.1|2249698|34|CP020451|CRISPRCasFinder matches to NC_015417 (Clostridium botulinum BKT015925 plasmid p1BKT015925, complete sequence) position: , mismatch: 10, identity: 0.706

aaccggtttttctggaacttcaaccacttttggt	CRISPR spacer
tttaagcttttctggaacttcatcctcttttaat	Protospacer
  . .*.*************** ** *****..*

3. spacer 2.2|212282|34|CP020451|PILER-CR matches to MN693484 (Marine virus AFVG_25M226, complete genome) position: , mismatch: 11, identity: 0.676

ttcactctttggtgtttctgatgctgaagtctcg	CRISPR spacer
tggcggtattgggctttctgatgctgaagtctat	Protospacer
*     . ****  ******************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 238775 : 282744 51 Streptococcus_phage(40.0%) protease,bacteriocin NA
DBSCAN-SWA_2 290022 : 297959 9 Streptococcus_phage(87.5%) NA NA
DBSCAN-SWA_3 310572 : 321476 10 Streptococcus_phage(87.5%) NA NA
DBSCAN-SWA_4 608997 : 614444 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_5 1070701 : 1108468 35 Streptococcus_phage(56.67%) capsid,tRNA,terminase NA
DBSCAN-SWA_6 1113085 : 1165512 57 Streptococcus_phage(71.11%) capsid,protease,tail,terminase,holin NA
DBSCAN-SWA_7 1522571 : 1532814 12 Streptococcus_phage(71.43%) NA NA
DBSCAN-SWA_8 1792338 : 1815132 26 Streptococcus_phage(90.48%) integrase,transposase attL 1785636:1785655|attR 1816753:1816772
DBSCAN-SWA_9 2047027 : 2057690 11 Streptococcus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage