1. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP053956 (Bacillus tropicus strain FDAARGOS_782 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
2. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP053956 (Bacillus tropicus strain FDAARGOS_782 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
3. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP053956 (Bacillus tropicus strain FDAARGOS_782 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
4. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP015591 (Bacillus cereus strain AR156 plasmid pAR41, complete sequence) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
5. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP009627 (Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
6. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP009627 (Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
7. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to NZ_CP009627 (Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence) position: , mismatch: 6, identity: 0.806
ttaaccatgagtatttaaattaaccatagct- CRISPR spacer
atatccattagtatttaaattaa-caaagcaa Protospacer
** **** ************** ** ***
8. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
tttttcagcaagtgcagacaatgcgcgacgtg Protospacer
******* ********.********* .*
9. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP016317 (Bacillus cereus strain M3 plasmid pBCM301, complete sequence) position: , mismatch: 7, identity: 0.781
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
tttttcagcaagtgcagacaatgcgcgacgtg Protospacer
******* ********.********* .*
10. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 7, identity: 0.781
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
tttttcagcaagtgcagacaatgcgcgacgtg Protospacer
******* ********.********* .*
11. spacer 1.10|70597|32|AP018690|CRISPRCasFinder,CRT matches to MN270892 (Pectobacterium phage Wc4-1, complete genome) position: , mismatch: 7, identity: 0.781
gttctttaggggagctaatacctccccttttt CRISPR spacer
gtgtctatggggagttaacacctccccttttt Protospacer
** ..* ******.***.*************
12. spacer 1.10|70597|32|AP018690|CRISPRCasFinder,CRT matches to MN270891 (Pectobacterium phage Wc4, complete genome) position: , mismatch: 7, identity: 0.781
gttctttaggggagctaatacctccccttttt CRISPR spacer
gtgtctatggggagttaacacctccccttttt Protospacer
** ..* ******.***.*************
13. spacer 1.10|70597|32|AP018690|CRISPRCasFinder,CRT matches to MK290738 (Pectobacterium phage Arno18, complete genome) position: , mismatch: 8, identity: 0.75
gttctttaggggagctaatacctccccttttt CRISPR spacer
gtatcgatggggagttaacacctccccttttt Protospacer
** .. ******.***.*************
14. spacer 1.10|70597|32|AP018690|CRISPRCasFinder,CRT matches to MK290737 (Pectobacterium phage Arno162, complete genome) position: , mismatch: 8, identity: 0.75
gttctttaggggagctaatacctccccttttt CRISPR spacer
gtatcgatggggagttaacacctccccttttt Protospacer
** .. ******.***.*************
15. spacer 1.11|70657|32|AP018690|CRISPRCasFinder,CRT matches to MN693224 (Marine virus AFVG_25M317, complete genome) position: , mismatch: 8, identity: 0.75
taatatgcttgttatggatagggagcgcggat CRISPR spacer
taatatgcgtgttatggataaggtagaagcat Protospacer
******** ***********.** . . * **
16. spacer 1.11|70657|32|AP018690|CRISPRCasFinder,CRT matches to MN693583 (Marine virus AFVG_25M274, complete genome) position: , mismatch: 8, identity: 0.75
taatatgcttgttatggatagggagcgcggat CRISPR spacer
taatatgcgtgttatggataaggtagaagcat Protospacer
******** ***********.** . . * **
17. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to JN377903 (Aeromonas phage Aes512 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and DNA primase-helicase subunit genes, complete cds) position: , mismatch: 8, identity: 0.75
ttgtggaacagaagaacaaaaac----cgcctttaa CRISPR spacer
ttgtgaaaaagaagaacaaaaacgcaacacca---- Protospacer
*****.** ************** *.**
18. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to AP014129 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C44-MedDCM-OCT-S34-C46, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
ttgtggaacagaagaacaaaaaccgcctttaa CRISPR spacer
ttttggaacagaagaacaagaactaattaaaa Protospacer
** ****************.***.. .* **
19. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 8, identity: 0.75
ttgtggaacagaagaacaaaaac----cgcctttaa CRISPR spacer
ttgtgaaaaagaagaacaaaaacgcaacacca---- Protospacer
*****.** ************** *.**
20. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to JN377904 (Aeromonas phage Aes517 DNA polymerase subunit, truncated putative GIY-YIG homing endonuclease, hypothetical protein, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75
ttgtggaacagaagaacaaaaac----cgcctttaa CRISPR spacer
ttgtgaaaaagaagaacaaaaacgcaacacca---- Protospacer
*****.** ************** *.**
21. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 8, identity: 0.75
ttgtggaacagaagaacaaaaac----cgcctttaa CRISPR spacer
ttgtgaaaaagaagaacaaaaacgcaacacca---- Protospacer
*****.** ************** *.**
22. spacer 1.43|72577|32|AP018690|CRISPRCasFinder,CRT matches to MK765584 (Tortoise microvirus 34 isolate 34_SP_129, complete genome) position: , mismatch: 8, identity: 0.75
gaagaacgtggcgatgacgaata-----catcaaacg CRISPR spacer
gaagaacgtggcggagacgaataagaatcttc----- Protospacer
*************. ******** * **
23. spacer 3.1|494078|31|AP018690|CRISPRCasFinder matches to MN693450 (Marine virus AFVG_25M486, complete genome) position: , mismatch: 8, identity: 0.742
ttaaccatgagtatttaaattaaccatagct CRISPR spacer
ttgttgctgattatttaaattagccatagca Protospacer
**. . *** ***********.*******
24. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
cttttcaccaggtgccaacaatgcaatgagtg Protospacer
.*********.**** ********. . *.*
25. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
cttttcaccaggtgccaacaatgcaatgagtg Protospacer
.*********.**** ********. . *.*
26. spacer 1.5|70297|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tttttcaccaagtgcaaacaatgcgcctaatt CRISPR spacer
cttttcaccaggtgccaacaatgcaatgagtg Protospacer
.*********.**** ********. . *.*
27. spacer 1.10|70597|32|AP018690|CRISPRCasFinder,CRT matches to KX017520 (Salmonella phage 64795_sal3, complete genome) position: , mismatch: 9, identity: 0.719
gttctttaggggagctaatacctccccttttt CRISPR spacer
tataaagaagggggctaatacccccccttttt Protospacer
* *.***.*********.*********
28. spacer 1.14|70837|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719
tataccgtagcgttgagcatcggaaacaacag CRISPR spacer
ttccacgtggccttgagcatcggaaacaccgc Protospacer
* . ***.** **************** *.
29. spacer 1.14|70837|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719
tataccgtagcgttgagcatcggaaacaacag CRISPR spacer
ttccacgtggccttgagcatcggaaacaccgc Protospacer
* . ***.** **************** *.
30. spacer 1.29|71737|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719
cacacgcaccggaatgccaaacacttccgcaa CRISPR spacer
ctgatcgaccggaatgccgaagacttccgcgg Protospacer
* *. ***********.** ********..
31. spacer 1.31|71857|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040803 (Streptococcus salivarius strain LAB813 plasmid pSAL813, complete sequence) position: , mismatch: 9, identity: 0.719
caccctgaaaactggcaaacctcagctttcac CRISPR spacer
ccttttctaaactgacaaacctcatctttcat Protospacer
* ...* ******.********* ******.
32. spacer 1.35|72097|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MN694387 (Marine virus AFVG_250M329, complete genome) position: , mismatch: 9, identity: 0.719
gtgcaagcattccaagaagttaagtataaaaa CRISPR spacer
ggaagagcattccaagatggtaagtatactac Protospacer
* . .************ * ******** *
33. spacer 1.35|72097|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MN940411 (Staphylococcus phage f2b1, partial genome) position: , mismatch: 9, identity: 0.719
gtgcaagcattccaagaagttaagtataaaaa CRISPR spacer
gaagatcgtttgcaagaagttaagaataaaaa Protospacer
* . * ** ************ *******
34. spacer 1.35|72097|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MN693994 (Marine virus AFVG_250M330, complete genome) position: , mismatch: 9, identity: 0.719
gtgcaagcattccaagaagttaagtataaaaa CRISPR spacer
ggaagagcattccaagatggtaagtatactac Protospacer
* . .************ * ******** *
35. spacer 1.35|72097|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MN694767 (Marine virus AFVG_250M328, complete genome) position: , mismatch: 9, identity: 0.719
gtgcaagcattccaagaagttaagtataaaaa CRISPR spacer
ggaagagcattccaagatggtaagtatactac Protospacer
* . .************ * ******** *
36. spacer 1.41|72457|32|AP018690|CRISPRCasFinder,CRT matches to MK620899 (Gordonia phage GodonK, complete genome) position: , mismatch: 9, identity: 0.719
accaaatcggtgcagctatgtgtgaactgatc CRISPR spacer
agatacgtcgtgcaggtatgtgcgaactgatc Protospacer
* * . ****** ******.*********
37. spacer 1.3|70177|32|AP018690|CRISPRCasFinder,CRT matches to MK504442 (Lactobacillus phage 3-SAC12, complete genome) position: , mismatch: 10, identity: 0.688
tttgaagatattgaacccatgaacatttcatg CRISPR spacer
tttgaagatattgaaaacatgaacggcaacga Protospacer
*************** *******. . .
38. spacer 1.7|70417|32|AP018690|CRISPRCasFinder,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 10, identity: 0.688
ttacttggcagttgaatattctaagcatgatc CRISPR spacer
aaaagaagctgttgaatatcctaagcatgaat Protospacer
* .** *********.********** .
39. spacer 1.7|70417|32|AP018690|CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 10, identity: 0.688
ttacttggcagttgaatattctaagcatgatc CRISPR spacer
aaaagaagctgttgaatatcctaagcatgaat Protospacer
* .** *********.********** .
40. spacer 1.7|70417|32|AP018690|CRISPRCasFinder,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 10, identity: 0.688
ttacttggcagttgaatattctaagcatgatc CRISPR spacer
aaaagaagctgttgaatatcctaagcatgaat Protospacer
* .** *********.********** .
41. spacer 1.7|70417|32|AP018690|CRISPRCasFinder,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 10, identity: 0.688
ttacttggcagttgaatattctaagcatgatc CRISPR spacer
aaaagaagctgttgaatatcctaagcatgaat Protospacer
* .** *********.********** .
42. spacer 1.7|70417|32|AP018690|CRISPRCasFinder,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 10, identity: 0.688
ttacttggcagttgaatattctaagcatgatc CRISPR spacer
aaaagaagctgttgaatatcctaagcatgaat Protospacer
* .** *********.********** .
43. spacer 1.11|70657|32|AP018690|CRISPRCasFinder,CRT matches to MN013077 (Klebsiella phage vB_KaeM_KaOmega, complete genome) position: , mismatch: 10, identity: 0.688
taatatgcttgttatggatagggagcgcggat CRISPR spacer
tgtactgcttcttctggatagggagcgcccgg Protospacer
*. ***** ** ************** .
44. spacer 1.14|70837|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 10, identity: 0.688
tataccgtagcgttgagcatcggaaacaacag CRISPR spacer
ccgaccgtagcgtcgagcttcggaaaggaact Protospacer
. **********.**** ******* .*
45. spacer 1.20|71197|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053574 (Citrobacter sp. TSA-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gtcaaagctcatatattgcttgccgtctttaa CRISPR spacer
cattccgctcatatattccttgccggcttcag Protospacer
. *********** ******* ***.*.
46. spacer 1.22|71317|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MT684590 (Streptomyces phage LilMartin, complete genome) position: , mismatch: 10, identity: 0.688
ttgcgaatgttcgcaaccaataacaactactt CRISPR spacer
gccgggcctttctcaaccaatatcaactactt Protospacer
. *. . *** ********* *********
47. spacer 1.22|71317|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MT897905 (Streptomyces phage MulchMansion, complete genome) position: , mismatch: 10, identity: 0.688
ttgcgaatgttcgcaaccaataacaactactt CRISPR spacer
gccgggcctttctcaaccaatatcaactactt Protospacer
. *. . *** ********* *********
48. spacer 1.23|71377|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 10, identity: 0.688
tatgttgtcggcaacatcgagcatcacatcac CRISPR spacer
gggcttgtcgccagcatcgagcatcactttga Protospacer
. ****** **.************* *..
49. spacer 1.34|72037|32|AP018690|CRISPRCasFinder,CRT matches to KM983334 (Clostridium phage phiCTC2B, complete genome) position: , mismatch: 10, identity: 0.688
ttgcaaagctggaataagtatagctggcataa CRISPR spacer
agttaaagctggaataaaaatagctggtagtt Protospacer
.*************. ********.*
50. spacer 1.34|72037|32|AP018690|CRISPRCasFinder,CRT matches to KM983331 (Clostridium phage phiCT19406B, complete genome) position: , mismatch: 10, identity: 0.688
ttgcaaagctggaataagtatagctggcataa CRISPR spacer
agttaaagctggaataaaaatagctggtagtt Protospacer
.*************. ********.*
51. spacer 1.35|72097|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to CP033552 (Acinetobacter nosocomialis strain 2014S01-097 plasmid p2014S01-097-2, complete sequence) position: , mismatch: 10, identity: 0.688
gtgcaagcattccaagaagttaagtataaaaa CRISPR spacer
tgattagctttccaagaagttcagtatattca Protospacer
.. *** ************ ****** *
52. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688
ttgtggaacagaagaacaaaaaccgcctttaa CRISPR spacer
ttttggaaaagaagaacaaaaacgattatccg Protospacer
** ***** ************** ... *. .
53. spacer 1.38|72277|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028898 (Gammaproteobacteria bacterium DM2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ttgtggaacagaagaacaaaaaccgcctttaa CRISPR spacer
ttggggaacagaagatcaaaaacacgggacat Protospacer
*** *********** ******* .*
54. spacer 1.4|70237|32|AP018690|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 11, identity: 0.656
tgattggtatccggatttttatcaacgaattt CRISPR spacer
gacgaagtatccggatttctatcaaggaaggg Protospacer
. .************.****** ***
55. spacer 1.40|72397|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MG592603 (Vibrio phage 1.238.A._10N.261.52.F10, partial genome) position: , mismatch: 11, identity: 0.656
atcgcctgttgtgtgtttttagtgtgttacca CRISPR spacer
gctatctgttgtgggtttttagtgagttcttc Protospacer
.....******** ********** *** ..
56. spacer 1.40|72397|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MG592610 (Vibrio phage 1.245.O._10N.261.54.C7, partial genome) position: , mismatch: 11, identity: 0.656
atcgcctgttgtgtgtttttagtgtgttacca CRISPR spacer
gctatctgttgtgggtttttagtgagttcttc Protospacer
.....******** ********** *** ..
57. spacer 1.40|72397|32|AP018690|CRISPRCasFinder,CRT,PILER-CR matches to MG592604 (Vibrio phage 1.238.B._10N.261.52.F10, partial genome) position: , mismatch: 11, identity: 0.656
atcgcctgttgtgtgtttttagtgtgttacca CRISPR spacer
gctatctgttgtgggtttttagtgagttcttc Protospacer
.....******** ********** *** ..
