Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022227 Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence 0 crisprs csa3,RT 0 0 2 0
CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 0 crisprs c2c9_V-U4 0 0 2 0
CP022229 Escherichia coli strain WCHEC96200 chromosome, complete genome 4 crisprs DEDDh,DinG,cas3,c2c9_V-U4,RT,WYL,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 7 8 0
CP022226 Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP022227
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10495 : 52485 50 Escherichia_phage(50.0%) transposase,integrase NA
DBSCAN-SWA_2 57338 : 88640 35 Escherichia_phage(37.5%) protease,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP022228
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 77439 103 Escherichia_phage(88.3%) portal,transposase,head,tail,capsid,plate,integrase,terminase attL 7314:7332|attR 67848:67866
DBSCAN-SWA_2 81745 : 90609 12 Escherichia_phage(75.0%) plate,tail,lysis,holin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP022229
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022229_1 285452-285575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022229_3 2365031-2365180 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022229_4 4129968-4130301 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022229_5 4157439-4158013 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022229_2 2.1|1033359|40|CP022229|CRISPRCasFinder 1033359-1033398 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP022229_1 1.1|285495|38|CP022229|CRISPRCasFinder 285495-285532 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP022229_5 5.4|4157648|35|CP022229|PILER-CR,CRISPRCasFinder,CRT 4157648-4157682 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
CP022229_4 4.3|4130119|32|CP022229|PILER-CR,CRISPRCasFinder,CRT 4130119-4130150 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
CP022229_4 4.1|4129997|32|CP022229|PILER-CR,CRISPRCasFinder,CRT 4129997-4130028 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
CP022229_4 4.1|4129997|32|CP022229|PILER-CR,CRISPRCasFinder,CRT 4129997-4130028 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
CP022229_4 4.4|4130180|32|CP022229|PILER-CR,CRISPRCasFinder,CRT 4130180-4130211 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
CP022229_5 5.5|4157709|35|CP022229|PILER-CR,CRISPRCasFinder,CRT 4157709-4157743 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 2.1|1033359|40|CP022229|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 1.1|285495|38|CP022229|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 5.4|4157648|35|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943 

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

4. spacer 4.3|4130119|32|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

5. spacer 4.1|4129997|32|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

6. spacer 4.1|4129997|32|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

7. spacer 4.4|4130180|32|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*

8. spacer 5.5|4157709|35|CP022229|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657 

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 371373 : 434650 84 Enterobacteria_phage(42.59%) capsid,terminase,transposase,tail,portal,lysis,head NA
DBSCAN-SWA_2 860398 : 918840 76 Escherichia_phage(35.85%) capsid,terminase,integrase,tRNA,tail,portal,lysis,holin,head attL 868591:868605|attR 918942:918956
DBSCAN-SWA_3 1279988 : 1336190 79 Enterobacteria_phage(37.93%) capsid,transposase,terminase,integrase,protease,tail,portal,holin,head attL 1302716:1302732|attR 1344065:1344081
DBSCAN-SWA_4 4174371 : 4181511 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_5 4557282 : 4595263 60 Enterobacteria_phage(48.28%) capsid,terminase,portal,lysis,holin,head NA
DBSCAN-SWA_6 4842832 : 4852275 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_7 4863714 : 4928801 75 Escherichia_phage(41.3%) capsid,transposase,terminase,integrase,tRNA,plate,tail,portal,lysis,holin,head attL 4891608:4891634|attR 4924487:4924513
DBSCAN-SWA_8 4976206 : 4983724 8 Escherichia_phage(42.86%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP022226
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11277 : 19383 8 Stx2-converting_phage(42.86%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage