Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022040 Prevotella melaninogenica strain FDAARGOS_306 chromosome 1, complete sequence 4 crisprs WYL,DEDDh,PD-DExK 0 0 2 0
CP022041 Prevotella melaninogenica strain FDAARGOS_306 chromosome 2, complete sequence 12 crisprs PrimPol,csa3,DEDDh,cas3 2 2 3 2

Results visualization

1. CP022041
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_1 171268-171358 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_2 298657-298793 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_3 351616-351726 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_4 415025-415115 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_5 479024-479203 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_6 507107-507208 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_7 509810-509892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_8 515345-515467 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_9 526884-526967 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_10 740687-740792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_11 1315103-1315206 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022041_12 1322540-1322693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022041_3 3.1|351643|57|CP022041|CRISPRCasFinder 351643-351699 57 CP022041.2 490724-490780 0 1.0
CP022041_3 3.1|351643|57|CP022041|CRISPRCasFinder 351643-351699 57 CP022041.2 490808-490864 0 1.0
CP022041_5 5.2|479165|28|CP022041|PILER-CR 479165-479192 28 CP022041.2 476356-476383 2 0.929

1. spacer 3.1|351643|57|CP022041|CRISPRCasFinder matches to position: 490724-490780, mismatch: 0, identity: 1.0

acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	CRISPR spacer
acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	Protospacer
*********************************************************

2. spacer 3.1|351643|57|CP022041|CRISPRCasFinder matches to position: 490808-490864, mismatch: 0, identity: 1.0

acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	CRISPR spacer
acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	Protospacer
*********************************************************

3. spacer 5.2|479165|28|CP022041|PILER-CR matches to position: 476356-476383, mismatch: 2, identity: 0.929

agcaacttgttaacttgtctactcgttg	CRISPR spacer
agcaacttgttcacttgtccactcgttg	Protospacer
*********** *******.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022041_5 5.2|479165|28|CP022041|PILER-CR 479165-479192 28 MK552327 Pseudomonas phage Psa21, complete genome 200921-200948 7 0.75
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 NZ_CP020004 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed2, complete sequence 38937-38965 7 0.759
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 NC_048762 Bacillus phage vB_BtS_B83, complete genome 5072-5100 7 0.759
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 KY290956 Aeromonas phage L9-6, complete genome 93770-93798 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 KY290951 Aeromonas phage 31.2, complete genome 93171-93199 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 NC_005135 Aeromonas phage 44RR2.8t, complete genome 93412-93440 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 AY962392 Aeromonas phage 31, complete genome 93174-93202 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 KY290958 Aeromonas phage SW69-9, complete genome 93306-93334 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 AY375531 Bacteriophage 44RR2.8t, complete genome 93412-93440 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 KY290948 Aeromonas phage 44RR2.8t.2, complete genome 93412-93440 8 0.724
CP022041_8 8.1|515392|29|CP022041|CRISPRCasFinder 515392-515420 29 KY290957 Aeromonas phage Riv-10, complete genome 94507-94535 8 0.724

1. spacer 5.2|479165|28|CP022041|PILER-CR matches to MK552327 (Pseudomonas phage Psa21, complete genome) position: , mismatch: 7, identity: 0.75

agcaacttgttaacttgtctactcgttg	CRISPR spacer
gtcaacttgctaacttgtctactactga	Protospacer
. *******.*************  * .

2. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to NZ_CP020004 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaggaacaagtgtttatgcctc	Protospacer
********* *****.*******     *

3. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to NC_048762 (Bacillus phage vB_BtS_B83, complete genome) position: , mismatch: 7, identity: 0.759

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaggaacaagtgtttatgcctc	Protospacer
********* *****.*******     *

4. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to KY290956 (Aeromonas phage L9-6, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

5. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to KY290951 (Aeromonas phage 31.2, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

6. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to NC_005135 (Aeromonas phage 44RR2.8t, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

7. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to AY962392 (Aeromonas phage 31, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

8. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to KY290958 (Aeromonas phage SW69-9, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

9. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to AY375531 (Bacteriophage 44RR2.8t, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

10. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to KY290948 (Aeromonas phage 44RR2.8t.2, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

11. spacer 8.1|515392|29|CP022041|CRISPRCasFinder matches to KY290957 (Aeromonas phage Riv-10, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 220916 : 251291 29 unidentified_phage(33.33%) transposase,integrase,protease attL 246311:246325|attR 256553:256567
DBSCAN-SWA_2 918244 : 925858 6 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1279773 : 1354453 52 Staphylococcus_phage(22.22%) transposase,integrase attL 1337644:1337658|attR 1366005:1366019
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP022041.2|ASE18007.1|74110_74530_-|PcfK-like-protein 74110_74530_- 139 aa aa 40 NA NA No NA
CP022041.2|ASE18124.1|255433_255853_+|PcfK-like-protein 255433_255853_+ 139 aa aa 40 NA NA No NA
2. CP022040
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022040_1 75267-75356 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022040_2 1282211-1282327 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022040_3 1513606-1513702 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022040_4 1623736-1623868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1079793 : 1132954 41 Lysinibacillus_phage(18.18%) integrase,tRNA,protease,transposase attL 1091372:1091391|attR 1111384:1111403
DBSCAN-SWA_2 1273406 : 1281876 9 Catovirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage