Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022044 Bacillus anthracis strain FDAARGOS_341 chromosome, complete genome 3 crisprs csa3,DEDDh,cas14j,cas3,WYL,c2c9_V-U4,cas14k,DinG 0 1 9 0
CP022045 Bacillus anthracis strain FDAARGOS_341 plasmid unnamed1, complete sequence 0 crisprs csa3,RT,c2c4_V-U1 0 0 0 0

Results visualization

1. CP022044
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022044_1 291853-292050 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022044_3 838733-838835 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022044_5 3976898-3977006 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 KJ094023 Listeria phage LP-101, complete genome 3876-3902 4 0.852
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NC_022766 Bacillus phage Glittering, complete genome 9024-9050 5 0.815
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1229260-1229286 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 438058-438084 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 127169-127195 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1227597-1227623 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 850854-850880 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 513839-513865 6 0.778
CP022044_2 2.1|670403|27|CP022044|CRISPRCasFinder 670403-670429 27 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 498252-498278 6 0.778

1. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 4, identity: 0.852

cgtctttggctcttctggtttctcttc	CRISPR spacer
catttctggctcttctggtttcttttc	Protospacer
*.*.*.*****************.***

2. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NC_022766 (Bacillus phage Glittering, complete genome) position: , mismatch: 5, identity: 0.815

cgtctttggctcttctggtttctcttc	CRISPR spacer
gttcaatggctcttctggtttctcatc	Protospacer
  **  ****************** **

3. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

4. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

5. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

6. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

7. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

8. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

9. spacer 2.1|670403|27|CP022044|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018290 : 1055165 44 uncultured_Caudovirales_phage(32.26%) protease,head,tail,portal,terminase,holin,capsid,transposase NA
DBSCAN-SWA_2 1067503 : 1079057 25 Bacillus_phage(68.42%) integrase attL 1061596:1061612|attR 1085392:1085408
DBSCAN-SWA_3 1285463 : 1361652 99 Bacillus_phage(92.98%) protease,head,tRNA,tail,portal,terminase,holin,capsid,integrase attL 1318861:1318877|attR 1363443:1363459
DBSCAN-SWA_4 2390261 : 2432495 51 Staphylococcus_phage(26.67%) protease,head,tRNA,portal,terminase,holin,capsid NA
DBSCAN-SWA_5 3097325 : 3105702 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 3246100 : 3276770 55 Bacillus_phage(70.73%) protease,head,tail,terminase,capsid,integrase attL 3250442:3250457|attR 3265106:3265121
DBSCAN-SWA_7 3280658 : 3284526 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_8 4638565 : 4647298 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_9 4956434 : 4963558 10 Bacillus_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage