Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018680 Vibrio casei DSM 22364 DNA, chromosome 1, complete geome 1 crisprs NA 0 1 0 0
AP018682 Vibrio casei DSM 22364 plasmid 1 DNA, complete genome 0 crisprs NA 0 0 0 0
AP018681 Vibrio casei DSM 22364 DNA, chromosome 2, complete geome 0 crisprs NA 0 0 0 0
AP018683 Vibrio casei DSM 22364 plasmid 2 DNA, complete genome 0 crisprs NA 0 0 0 0
AP018684 Vibrio casei DSM 22364 plasmid 3 DNA, complete genome 0 crisprs NA 0 0 0 0

Results visualization

1. AP018680
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018680_1 1087477-1087684 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018680_1 1.1|1087510|27|AP018680|PILER-CR 1087510-1087536 27 NZ_CP042181 Pseudomonas sp. KBS0802 plasmid unnamed, complete sequence 69705-69731 4 0.852
AP018680_1 1.1|1087510|27|AP018680|PILER-CR 1087510-1087536 27 NC_014124 Pseudomonas putida plasmid pDK1, complete sequence 86914-86940 4 0.852
AP018680_1 1.1|1087510|27|AP018680|PILER-CR 1087510-1087536 27 NC_003350 Pseudomonas putida plasmid pWW0, complete sequence 71457-71483 4 0.852
AP018680_1 1.1|1087510|27|AP018680|PILER-CR 1087510-1087536 27 NC_008275 Pseudomonas putida MT53 plasmid pWW53, complete sequence 65982-66008 4 0.852
AP018680_1 1.1|1087510|27|AP018680|PILER-CR 1087510-1087536 27 NZ_CP033221 Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence 146611-146637 7 0.741

1. spacer 1.1|1087510|27|AP018680|PILER-CR matches to NZ_CP042181 (Pseudomonas sp. KBS0802 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

gaccgcaacccagcgggcgcacaaatg	CRISPR spacer
tttcgcaacccagcgggcgcacaattg	Protospacer
  .********************* **

2. spacer 1.1|1087510|27|AP018680|PILER-CR matches to NC_014124 (Pseudomonas putida plasmid pDK1, complete sequence) position: , mismatch: 4, identity: 0.852

gaccgcaacccagcgggcgcacaaatg	CRISPR spacer
tttcgcaacccagcgggcgcacaattg	Protospacer
  .********************* **

3. spacer 1.1|1087510|27|AP018680|PILER-CR matches to NC_003350 (Pseudomonas putida plasmid pWW0, complete sequence) position: , mismatch: 4, identity: 0.852

gaccgcaacccagcgggcgcacaaatg	CRISPR spacer
tttcgcaacccagcgggcgcacaattg	Protospacer
  .********************* **

4. spacer 1.1|1087510|27|AP018680|PILER-CR matches to NC_008275 (Pseudomonas putida MT53 plasmid pWW53, complete sequence) position: , mismatch: 4, identity: 0.852

gaccgcaacccagcgggcgcacaaatg	CRISPR spacer
tttcgcaacccagcgggcgcacaattg	Protospacer
  .********************* **

5. spacer 1.1|1087510|27|AP018680|PILER-CR matches to NZ_CP033221 (Parasedimentitalea marina strain W43 plasmid pW43B, complete sequence) position: , mismatch: 7, identity: 0.741

gaccgcaacccagcgggcgcacaaatg	CRISPR spacer
gaccgcaacccagtgggcgcagctgct	Protospacer
*************.*******   .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage