Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018688 Vibrio rumoiensis FERM P-14531 plasmid 2 DNA, complete genome 0 crisprs NA 0 0 0 0
AP018687 Vibrio rumoiensis FERM P-14531 plasmid 1 DNA, complete genome 0 crisprs NA 0 0 0 0
AP018685 Vibrio rumoiensis FERM P-14531 DNA, chromosome 1, complete geome 1 crisprs NA 0 2 0 0
AP018686 Vibrio rumoiensis FERM P-14531 DNA, chromosome 2, complete geome 0 crisprs NA 0 0 0 0

Results visualization

1. AP018685
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018685_1 2478117-2478265 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018685_1 1.2|2478206|31|AP018685|PILER-CR 2478206-2478236 31 NZ_CP045341 Vibrio sp. THAF190c plasmid pTHAF190c_c, complete sequence 148844-148874 5 0.839
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NZ_CP045341 Vibrio sp. THAF190c plasmid pTHAF190c_c, complete sequence 148844-148875 5 0.844
AP018685_1 1.2|2478206|31|AP018685|PILER-CR 2478206-2478236 31 NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 73851-73881 7 0.774
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 73850-73881 7 0.781
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NZ_CP010589 Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence 216095-216126 8 0.75
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NZ_CP010674 Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence 216095-216126 8 0.75
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NC_023138 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence 215603-215634 8 0.75
AP018685_1 1.4|2478205|32|AP018685|CRISPRCasFinder 2478205-2478236 32 NZ_CP010637 Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence 216095-216126 8 0.75

1. spacer 1.2|2478206|31|AP018685|PILER-CR matches to NZ_CP045341 (Vibrio sp. THAF190c plasmid pTHAF190c_c, complete sequence) position: , mismatch: 5, identity: 0.839 

gatcagcaaatgggtcatcttgacgcgctgc	CRISPR spacer
gatctgcaaatgggtcatcttgtcgtaccgc	Protospacer
**** ***************** **..*.**

2. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NZ_CP045341 (Vibrio sp. THAF190c plasmid pTHAF190c_c, complete sequence) position: , mismatch: 5, identity: 0.844 

tgatcagcaaatgggtcatcttgacgcgctgc	CRISPR spacer
tgatctgcaaatgggtcatcttgtcgtaccgc	Protospacer
***** ***************** **..*.**

3. spacer 1.2|2478206|31|AP018685|PILER-CR matches to NZ_CP014310 (Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774 

gatcagcaaatgggtcatcttgacgcgctgc	CRISPR spacer
ggcctgagaatgggtcatcctgaagcgctgc	Protospacer
*..* * .***********.*** *******

4. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NZ_CP014310 (Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

tgatcagcaaatgggtcatcttgacgcgctgc	CRISPR spacer
tggcctgagaatgggtcatcctgaagcgctgc	Protospacer
**..* * .***********.*** *******

5. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NZ_CP010589 (Phaeobacter gallaeciensis strain P11 plasmid pP11_a, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcaaatgggtcatcttgac----gcgctgc	CRISPR spacer
tgatcagcaaatgaggcatcttggtcccggcg----	Protospacer
*************.* *******..    ***

6. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NZ_CP010674 (Phaeobacter gallaeciensis strain P75 plasmid pP75_a, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcaaatgggtcatcttgac----gcgctgc	CRISPR spacer
tgatcagcaaatgaggcatcttggtcccggcg----	Protospacer
*************.* *******..    ***

7. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NC_023138 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_A255, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcaaatgggtcatcttgac----gcgctgc	CRISPR spacer
tgatcagcaaatgaggcatcttggtcccggcg----	Protospacer
*************.* *******..    ***

8. spacer 1.4|2478205|32|AP018685|CRISPRCasFinder matches to NZ_CP010637 (Phaeobacter gallaeciensis strain P73 plasmid pP73_a, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcaaatgggtcatcttgac----gcgctgc	CRISPR spacer
tgatcagcaaatgaggcatcttggtcccggcg----	Protospacer
*************.* *******..    ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage