Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 0 crisprs RT 0 0 2 0
CP028801 Klebsiella pneumoniae strain WCHKP7E2 plasmid p1_085072, complete sequence 0 crisprs NA 0 0 0 0
CP028802 Klebsiella pneumoniae strain WCHKP7E2 plasmid p2_085072, complete sequence 0 crisprs NA 0 0 0 0
CP028806 Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 1 7 0
CP028803 Klebsiella pneumoniae strain WCHKP7E2 plasmid p3_085072, complete sequence 0 crisprs NA 0 0 0 0
CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 0 crisprs csa3,RT,DEDDh 0 0 2 0

Results visualization

1. CP028806
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028806_2 4530687-4530781 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028806_1 1.1|4045449|36|CP028806|CRISPRCasFinder 4045449-4045484 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP028806_1 1.1|4045449|36|CP028806|CRISPRCasFinder 4045449-4045484 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP028806_1 1.1|4045449|36|CP028806|CRISPRCasFinder 4045449-4045484 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|4045449|36|CP028806|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|4045449|36|CP028806|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|4045449|36|CP028806|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 446643 : 516021 75 uncultured_Caudovirales_phage(61.11%) head,capsid,portal,integrase,terminase,protease,tail,tRNA attL 464251:464268|attR 480246:480263
DBSCAN-SWA_2 2747189 : 2758076 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 2952117 : 3023614 82 uncultured_Caudovirales_phage(34.0%) head,terminase,plate,protease,tail,lysis NA
DBSCAN-SWA_4 3311536 : 3320461 7 Salmonella_phage(33.33%) tail NA
DBSCAN-SWA_5 3475324 : 3565049 98 Salmonella_phage(57.63%) head,capsid,portal,integrase,plate,protease,tail,tRNA,lysis attL 3530850:3530868|attR 3565124:3565142
DBSCAN-SWA_6 3981631 : 4056539 90 Escherichia_phage(23.33%) coat,head,terminase,integrase,transposase,tail,tRNA,lysis attL 4003376:4003422|attR 4053611:4053657
DBSCAN-SWA_7 4267400 : 4279054 13 Enterobacteria_phage(70.0%) integrase attL 4267850:4267864|attR 4290907:4290921
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028805
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15530 : 26689 11 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 103804 : 130635 25 Salmonella_phage(27.27%) transposase,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP028804
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 107708 : 153767 47 uncultured_Caudovirales_phage(30.77%) transposase,protease NA
DBSCAN-SWA_2 213092 : 305990 104 Escherichia_phage(42.86%) transposase,integrase,bacteriocin attL 255245:255304|attR 308642:308657
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage