Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033875 Caulobacter sp. FWC26 chromosome, complete genome 1 crisprs csa3,WYL,cas3,DinG,DEDDh 0 7 3 0
CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 0 crisprs DEDDh 0 0 0 0
CP033874 Caulobacter sp. FWC26 plasmid p2 0 crisprs NA 0 0 0 0

Results visualization

1. CP033875
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033875_3 4464962-4465050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033875_1 1.1|2569480|26|CP033875|CRT 2569480-2569505 26 MK977696 Gordonia phage SCentae, complete genome 73229-73254 4 0.846
CP033875_1 1.1|2569480|26|CP033875|CRT 2569480-2569505 26 MK977695 Gordonia phage Pupper, complete genome 73076-73101 4 0.846
CP033875_1 1.1|2569480|26|CP033875|CRT 2569480-2569505 26 NZ_CP044991 Deinococcus sp. AJ005 plasmid p115k, complete sequence 107269-107294 5 0.808
CP033875_3 3.1|4464993|27|CP033875|CRISPRCasFinder 4464993-4465019 27 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 223831-223857 5 0.815
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 247726-247754 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 383947-383975 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 842539-842567 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 224834-224862 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 246190-246218 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 246190-246218 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 246190-246218 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 246190-246218 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 246190-246218 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 126111-126139 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 403925-403953 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1710131-1710159 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 185401-185429 6 0.793
CP033875_1 1.3|2569576|29|CP033875|CRT 2569576-2569604 29 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 81845-81873 6 0.793
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 731757-731788 7 0.781
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NC_047816 Ralstonia phage RS-PI-1, complete genome 9015-9046 8 0.75
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 119060-119091 8 0.75
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 MG009575 Mycobacterium phage Kumao, complete genome 27486-27517 8 0.75
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 277487-277520 8 0.765
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP024907 Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence 149908-149941 8 0.765
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 611530-611561 9 0.719
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_LR134469 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence 130966-130997 9 0.719
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 565449-565480 9 0.719
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 129996-130027 9 0.719
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 684032-684063 9 0.719
CP033875_2 2.1|2976086|34|CP033875|CRISPRCasFinder 2976086-2976119 34 NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 26585-26618 9 0.735
CP033875_2 2.1|2976086|34|CP033875|CRISPRCasFinder 2976086-2976119 34 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1259458-1259491 9 0.735
CP033875_2 2.1|2976086|34|CP033875|CRISPRCasFinder 2976086-2976119 34 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1264127-1264160 9 0.735
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 227051-227084 9 0.735
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 49479-49512 9 0.735
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 512600-512633 9 0.735
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 215592-215625 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 605370-605403 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 593725-593758 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 490929-490962 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 560301-560334 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 490929-490962 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 494806-494839 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 494796-494829 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 490941-490974 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 490961-490994 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 490914-490947 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 605417-605450 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 605417-605450 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 605408-605441 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 69171-69204 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 539726-539759 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 552754-552787 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1522565-1522598 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1149280-1149313 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1364185-1364218 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 555863-555896 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 389578-389611 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 655039-655072 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 715124-715157 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 212240-212273 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 930756-930789 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 560855-560888 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 95745-95778 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1643292-1643325 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 796420-796453 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 558316-558349 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1622173-1622206 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 568585-568618 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 554264-554297 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 471211-471244 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 553347-553380 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 515651-515684 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 557193-557226 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1435173-1435206 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 558321-558354 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 617314-617347 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 561759-561792 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 574129-574162 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 551266-551299 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 617314-617347 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 561759-561792 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 617314-617347 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 551294-551327 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 617318-617351 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 561759-561792 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 561759-561792 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 561759-561792 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1540714-1540747 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 551294-551327 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 568568-568601 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 568520-568553 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 602974-603007 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 560333-560366 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 560270-560303 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 551294-551327 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 617314-617347 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 649367-649400 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 574128-574161 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 551294-551327 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 551294-551327 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 561761-561794 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1512463-1512496 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 574131-574164 9 0.735
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1512463-1512496 9 0.735
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP016593 Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence 94329-94360 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NC_017386 Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence 29525-29556 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 163809-163840 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NC_014621 Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence 264790-264821 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 94332-94363 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP039924 Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence 175436-175467 10 0.688
CP033875_1 1.2|2569525|32|CP033875|CRT 2569525-2569556 32 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 127363-127394 10 0.688
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 470894-470927 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NC_010070 Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence 150915-150948 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP018385 Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence 5582-5615 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 214090-214123 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 294645-294678 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NC_010802 Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence 129960-129993 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 CP000618 Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence 140876-140909 10 0.706
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 KR080199 Mycobacterium phage Baee, complete genome 49804-49837 10 0.706
CP033875_2 2.2|2976143|34|CP033875|CRISPRCasFinder 2976143-2976176 34 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 45089-45122 11 0.676
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NZ_CP015420 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence 88416-88449 11 0.676
CP033875_2 2.4|2976260|34|CP033875|CRISPRCasFinder 2976260-2976293 34 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 501399-501432 11 0.676

1. spacer 1.1|2569480|26|CP033875|CRT matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 4, identity: 0.846

gccggcggggtacgcccacccgcacc	CRISPR spacer
accggcggggtacgccaacccgttcc	Protospacer
.*************** *****. **

2. spacer 1.1|2569480|26|CP033875|CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 4, identity: 0.846

gccggcggggtacgcccacccgcacc	CRISPR spacer
accggcggggtacgccaacccgttcc	Protospacer
.*************** *****. **

3. spacer 1.1|2569480|26|CP033875|CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 5, identity: 0.808

gccggcggggtacgcccacccgcacc	CRISPR spacer
cacggcggggtacgccagcccgcaca	Protospacer
  ************** .******* 

4. spacer 3.1|4464993|27|CP033875|CRISPRCasFinder matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 5, identity: 0.815

ggcgcgccgacccaaggtcggctgggg	CRISPR spacer
gtcgcgcccacccaaggacggctggac	Protospacer
* ****** ******** *******. 

5. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

6. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

7. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

8. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

9. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

10. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

11. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

12. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

13. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

14. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
aaggccatgaccccgaccacccggccgtc	Protospacer
* ******* *********** ****  .

15. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

16. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

17. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

18. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.793

atggccatgcccccgaccaccaggcccgt	CRISPR spacer
ctcgccatgcccccgaccaccccgcccca	Protospacer
 * ******************  ****  

19. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
caggacgcggcgacgccgctcgccgcgctcgc	Protospacer
* ******* * **************  **  

20. spacer 1.2|2569525|32|CP033875|CRT matches to NC_047816 (Ralstonia phage RS-PI-1, complete genome) position: , mismatch: 8, identity: 0.75

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
atgaagccgcccacgccgctcgccgcgatcac	Protospacer
 .*.*  ******************* ***  

21. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.75

ccggacgcgcccacgccgctcgc-----cgccatctg	CRISPR spacer
ccgaacgcgcccaggccgctcgcacgctcgac-----	Protospacer
***.********* *********     ** *     

22. spacer 1.2|2569525|32|CP033875|CRT matches to MG009575 (Mycobacterium phage Kumao, complete genome) position: , mismatch: 8, identity: 0.75

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
ggggccgcgcccacgccgcccgccggggactg	Protospacer
  ** **************.*****  . ***

23. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 8, identity: 0.765

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
aagggctcgacgtcgcccgctgcaccgttgcccg	Protospacer
.* .******* ********* ********   *

24. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 8, identity: 0.765

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
ggcacgccgacctcgaccgcatcaccgttgatgt	Protospacer
*.**  .******** **** ********** * 

25. spacer 1.2|2569525|32|CP033875|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
tcggacgcgcccacgccgatcgtcgtcggaaa	Protospacer
.***************** ***.**.*.   .

26. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
gtcgacgtgccgacgccgctcgccgccgcggg	Protospacer
 . ****.*** ***************..  *

27. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
gcgagcgcggacacgccgctcgccgccacggc	Protospacer
 **..****  *****************.   

28. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacgcgcccacgccgctcgccgc-catctg	CRISPR spacer
agcgacgcgcccgcgccgatcgccgcgcgacc-	Protospacer
   *********.***** ******* *. *. 

29. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
atcgccgcgctcaccccgctcgccgccacggg	Protospacer
 . * *****.*** *************.  *

30. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 9, identity: 0.735

tgtttcttcaccgggcccgtgaccttggcgatct	CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg	Protospacer
  **. ..***********.******* ***** 

31. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.735

tgtttcttcaccgggcccgtgaccttggcgatct	CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg	Protospacer
  **. ..***********.******* ***** 

32. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.735

tgtttcttcaccgggcccgtgaccttggcgatct	CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg	Protospacer
  **. ..***********.******* ***** 

33. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.735

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg	Protospacer
 .*** *****************.*** ..*. *

34. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.735

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg	Protospacer
 .*** *****************.*** ..*. *

35. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.735

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg	Protospacer
 .*** *****************.*** ..*. *

36. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.735

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg	Protospacer
 .*** *****************.*** ..*. *

37. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

38. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

39. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

40. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

41. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

42. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

43. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

44. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

45. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

46. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

47. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

48. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

49. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

50. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

51. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

52. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

53. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

54. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

55. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

56. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

57. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

58. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

59. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

60. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

61. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

62. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

63. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

64. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

65. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

66. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

67. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

68. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

69. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

70. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

71. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

72. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

73. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

74. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

75. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

76. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

77. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

78. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

79. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

80. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

81. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

82. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

83. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

84. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

85. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

86. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

87. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

88. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

89. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

90. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

91. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

92. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

93. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

94. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

95. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

96. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

97. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

98. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

99. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

100. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

101. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

102. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

103. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

104. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

105. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

106. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

107. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

108. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

109. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

110. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

111. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

112. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg	Protospacer
 ** *  .**********.******** ****  

113. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg	Protospacer
    *********.** ********** .. *

114. spacer 1.2|2569525|32|CP033875|CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg	Protospacer
    *********.** ********** .. *

115. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
cgccgcgctcccatgccgctcgccgccagact	Protospacer
*   .*** ****.**************  . 

116. spacer 1.2|2569525|32|CP033875|CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg	Protospacer
    *********.** ********** .. *

117. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg	Protospacer
    *********.** ********** .. *

118. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
agcagcgcgcccatgcggctcgccgccaggcg	Protospacer
   ..********.** ***********  .*

119. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacgcgcccacgccgctcgccgccatctg	CRISPR spacer
cgccgcgctcccatgccgctcgccgccaggct	Protospacer
*   .*** ****.**************  . 

120. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 10, identity: 0.706

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
aggtggccgacctcgcccgcatcaccgtggacga	Protospacer
..  * .************* ******* ** *.

121. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

122. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

123. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

124. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

125. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

126. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct	Protospacer
*  .  . ** * ********************.

127. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to KR080199 (Mycobacterium phage Baee, complete genome) position: , mismatch: 10, identity: 0.706

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
agctgttccagcttgccgccgctgcaggcgggcg	Protospacer
   . **************** *** ****. * 

128. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 11, identity: 0.676

gacagctcgacctcgcccgcttcaccgttgaagg	CRISPR spacer
tgcagatcgagctcgcccgcttcaccggccgcct	Protospacer
 .*** **** **************** . .   

129. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
gacaaatcgagcttgccgccgatgctgccgctcg	Protospacer
      ** ****************** ** .* 

130. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 11, identity: 0.676

ttgccttccagcttgccgccgatgctggcgaccc	CRISPR spacer
ctgccatccagcttgccgctgatgcccagcgtgc	Protospacer
.**** *************.*****. .  .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1874128 : 1882215 10 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_2 1957444 : 1966472 9 uncultured_Mediterranean_phage(57.14%) NA NA
DBSCAN-SWA_3 3453248 : 3457362 8 Burkholderia_phage(50.0%) capsid,head,tail,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage