1. spacer 1.1|2569480|26|CP033875|CRT matches to MK977696 (Gordonia phage SCentae, complete genome) position: , mismatch: 4, identity: 0.846
gccggcggggtacgcccacccgcacc CRISPR spacer
accggcggggtacgccaacccgttcc Protospacer
.*************** *****. **
2. spacer 1.1|2569480|26|CP033875|CRT matches to MK977695 (Gordonia phage Pupper, complete genome) position: , mismatch: 4, identity: 0.846
gccggcggggtacgcccacccgcacc CRISPR spacer
accggcggggtacgccaacccgttcc Protospacer
.*************** *****. **
3. spacer 1.1|2569480|26|CP033875|CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 5, identity: 0.808
gccggcggggtacgcccacccgcacc CRISPR spacer
cacggcggggtacgccagcccgcaca Protospacer
************** .*******
4. spacer 3.1|4464993|27|CP033875|CRISPRCasFinder matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 5, identity: 0.815
ggcgcgccgacccaaggtcggctgggg CRISPR spacer
gtcgcgcccacccaaggacggctggac Protospacer
* ****** ******** *******.
5. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
6. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
7. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
8. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
9. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
10. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
11. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
12. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
13. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
14. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
aaggccatgaccccgaccacccggccgtc Protospacer
* ******* *********** **** .
15. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
16. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
17. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
18. spacer 1.3|2569576|29|CP033875|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.793
atggccatgcccccgaccaccaggcccgt CRISPR spacer
ctcgccatgcccccgaccaccccgcccca Protospacer
* ****************** ****
19. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
caggacgcggcgacgccgctcgccgcgctcgc Protospacer
* ******* * ************** **
20. spacer 1.2|2569525|32|CP033875|CRT matches to NC_047816 (Ralstonia phage RS-PI-1, complete genome) position: , mismatch: 8, identity: 0.75
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
atgaagccgcccacgccgctcgccgcgatcac Protospacer
.*.* ******************* ***
21. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.75
ccggacgcgcccacgccgctcgc-----cgccatctg CRISPR spacer
ccgaacgcgcccaggccgctcgcacgctcgac----- Protospacer
***.********* ********* ** *
22. spacer 1.2|2569525|32|CP033875|CRT matches to MG009575 (Mycobacterium phage Kumao, complete genome) position: , mismatch: 8, identity: 0.75
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
ggggccgcgcccacgccgcccgccggggactg Protospacer
** **************.***** . ***
23. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 8, identity: 0.765
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
aagggctcgacgtcgcccgctgcaccgttgcccg Protospacer
.* .******* ********* ******** *
24. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP024907 (Paraburkholderia caledonica strain PHRS4 plasmid pPHRS4, complete sequence) position: , mismatch: 8, identity: 0.765
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
ggcacgccgacctcgaccgcatcaccgttgatgt Protospacer
*.** .******** **** ********** *
25. spacer 1.2|2569525|32|CP033875|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
tcggacgcgcccacgccgatcgtcgtcggaaa Protospacer
.***************** ***.**.*. .
26. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 9, identity: 0.719
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
gtcgacgtgccgacgccgctcgccgccgcggg Protospacer
. ****.*** ***************.. *
27. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
gcgagcgcggacacgccgctcgccgccacggc Protospacer
**..**** *****************.
28. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.719
ccggacgcgcccacgccgctcgccgc-catctg CRISPR spacer
agcgacgcgcccgcgccgatcgccgcgcgacc- Protospacer
*********.***** ******* *. *.
29. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
atcgccgcgctcaccccgctcgccgccacggg Protospacer
. * *****.*** *************. *
30. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 9, identity: 0.735
tgtttcttcaccgggcccgtgaccttggcgatct CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg Protospacer
**. ..***********.******* *****
31. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.735
tgtttcttcaccgggcccgtgaccttggcgatct CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg Protospacer
**. ..***********.******* *****
32. spacer 2.1|2976086|34|CP033875|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.735
tgtttcttcaccgggcccgtgaccttggcgatct CRISPR spacer
gcttcacccaccgggcccgcgaccttgtcgatcg Protospacer
**. ..***********.******* *****
33. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.735
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg Protospacer
.*** *****************.*** ..*. *
34. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.735
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg Protospacer
.*** *****************.*** ..*. *
35. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.735
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg Protospacer
.*** *****************.*** ..*. *
36. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.735
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
cgcaggtcgacctcgcccgcttcgccggcaagcg Protospacer
.*** *****************.*** ..*. *
37. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
38. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
39. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
40. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
41. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
42. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
43. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
44. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
45. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
46. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
47. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
48. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
49. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
50. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
51. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
52. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
53. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
54. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
55. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
56. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
57. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
58. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
59. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
60. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
61. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
62. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
63. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
64. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
65. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
66. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
67. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
68. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
69. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
70. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
71. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
72. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
73. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
74. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
75. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
76. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
77. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
78. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
79. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
80. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
81. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
82. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
83. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
84. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
85. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
86. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
87. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
88. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
89. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
90. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
91. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
92. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
93. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
94. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
95. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
96. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
97. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
98. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
99. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
100. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
101. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
102. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
103. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
104. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
105. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
106. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
107. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
108. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
109. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
110. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
111. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
112. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.735
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gtggcggtcagcttgccgtcgatgctgtcgacgg Protospacer
** * .**********.******** ****
113. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg Protospacer
*********.** ********** .. *
114. spacer 1.2|2569525|32|CP033875|CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg Protospacer
*********.** ********** .. *
115. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
cgccgcgctcccatgccgctcgccgccagact Protospacer
* .*** ****.************** .
116. spacer 1.2|2569525|32|CP033875|CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg Protospacer
*********.** ********** .. *
117. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
aattacgcgcccatgcggctcgccgcctctgg Protospacer
*********.** ********** .. *
118. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
agcagcgcgcccatgcggctcgccgccaggcg Protospacer
..********.** *********** .*
119. spacer 1.2|2569525|32|CP033875|CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 10, identity: 0.688
ccggacgcgcccacgccgctcgccgccatctg CRISPR spacer
cgccgcgctcccatgccgctcgccgccaggct Protospacer
* .*** ****.************** .
120. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 10, identity: 0.706
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
aggtggccgacctcgcccgcatcaccgtggacga Protospacer
.. * .************* ******* ** *.
121. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
122. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
123. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
124. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
125. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
126. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
tactggcgcaccatgccgccgatgctggcgacct Protospacer
* . . ** * ********************.
127. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to KR080199 (Mycobacterium phage Baee, complete genome) position: , mismatch: 10, identity: 0.706
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
agctgttccagcttgccgccgctgcaggcgggcg Protospacer
. **************** *** ****. *
128. spacer 2.2|2976143|34|CP033875|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 11, identity: 0.676
gacagctcgacctcgcccgcttcaccgttgaagg CRISPR spacer
tgcagatcgagctcgcccgcttcaccggccgcct Protospacer
.*** **** **************** . .
129. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
gacaaatcgagcttgccgccgatgctgccgctcg Protospacer
** ****************** ** .*
130. spacer 2.4|2976260|34|CP033875|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 11, identity: 0.676
ttgccttccagcttgccgccgatgctggcgaccc CRISPR spacer
ctgccatccagcttgccgctgatgcccagcgtgc Protospacer
.**** *************.*****. . .. *