Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 0 crisprs csa3,cas3,RT 0 0 2 0
CP028785 Klebsiella pneumoniae strain SCKP020049 plasmid p2_020049, complete sequence 0 crisprs NA 0 0 0 0
CP028787 Klebsiella pneumoniae strain SCKP020049 chromosome, complete genome 2 crisprs WYL,csa3,cas3,DEDDh,DinG,RT 0 1 9 0
CP028786 Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. CP028784
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1727 : 61239 56 uncultured_Caudovirales_phage(29.41%) integrase,transposase NA
DBSCAN-SWA_2 83636 : 117740 29 Bacillus_virus(16.67%) integrase,transposase,bacteriocin attL 79986:80003|attR 120772:120789
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028786
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 36370 45 Escherichia_phage(50.0%) transposase,coat NA
DBSCAN-SWA_2 50611 : 52451 2 Moraxella_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP028787
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028787_2 4153267-4153395 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028787_3 4370234-4370328 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028787_1 1.1|1880161|30|CP028787|CRISPRCasFinder 1880161-1880190 30 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 21741-21770 0 1.0

1. spacer 1.1|1880161|30|CP028787|CRISPRCasFinder matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 0, identity: 1.0

gcattcggcataaacgccatatccaggatt	CRISPR spacer
gcattcggcataaacgccatatccaggatt	Protospacer
******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1191359 : 1200806 10 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_2 1317111 : 1360327 54 Salmonella_phage(33.33%) holin,integrase,tail,transposase,terminase attL 1314538:1314553|attR 1341946:1341961
DBSCAN-SWA_3 1702833 : 1709740 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_4 1751304 : 1761206 8 Escherichia_phage(37.5%) transposase NA
DBSCAN-SWA_5 1866442 : 1950907 100 Enterobacteria_phage(21.05%) capsid,head,holin,tail,tRNA,portal,terminase,protease NA
DBSCAN-SWA_6 2709447 : 2720335 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3104732 : 3187445 96 Klebsiella_phage(43.48%) capsid,head,holin,tail,integrase,tRNA,portal,terminase attL 3131547:3131561|attR 3185256:3185270
DBSCAN-SWA_8 3424427 : 3433891 9 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_9 4610765 : 4622797 11 Enterobacteria_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage