Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025591 Lactobacillus plantarum strain K259 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP025590 Lactobacillus plantarum strain K259 chromosome, complete genome 3 crisprs NA 1 9 0 0

Results visualization

1. CP025590
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025590_1 921635-924255 Orphan NA
26 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025590_2 2285781-2286006 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025590_3 2470536-2470621 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP025590_2 2.1|2285839|26|CP025590|PILER-CR 2285839-2285864 26 CP025590.1 2285755-2285780 0 1.0

1. spacer 2.1|2285839|26|CP025590|PILER-CR matches to position: 2285755-2285780, mismatch: 0, identity: 1.0

cattcaatgttccaagcccattagta	CRISPR spacer
cattcaatgttccaagcccattagta	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157297-157327 0 1.0
CP025590_1 1.19|923662|19|CP025590|CRT 923662-923680 19 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151492-151510 0 1.0
CP025590_1 1.19|923662|19|CP025590|CRT 923662-923680 19 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155575-155593 0 1.0
CP025590_1 1.19|923662|19|CP025590|CRT 923662-923680 19 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157495-157513 0 1.0
CP025590_1 1.19|923662|19|CP025590|CRT 923662-923680 19 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3526-3544 0 1.0
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157477-157513 0 1.0
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157495-157525 1 0.968
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157585-157615 1 0.968
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1540-1570 1 0.968
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1954-1984 1 0.968
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3166-3196 1 0.968
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 982-1012 1 0.968
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154039-154069 1 0.968
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154237-154273 1 0.973
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154627-154663 1 0.973
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154861-154897 1 0.973
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156319-156349 2 0.935
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157423-157453 2 0.935
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157261-157291 2 0.935
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2272-2302 2 0.935
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3040-3070 2 0.935
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155899-155929 2 0.935
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152002-152032 2 0.935
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156025-156055 2 0.935
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2536-2566 2 0.935
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157567-157603 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151780-151816 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153451-153487 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153649-153685 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153667-153703 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154393-154429 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154411-154447 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155059-155095 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155293-155329 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156823-156859 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156841-156877 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156991-157027 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157009-157045 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157135-157171 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157243-157279 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157459-157495 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157549-157585 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2254-2290 2 0.946
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1108-1144 2 0.946
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151492-151522 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153061-153091 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153907-153937 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154465-154495 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154663-154693 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154879-154909 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155077-155107 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155311-155341 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155575-155605 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1054-1084 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1252-1282 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1486-1516 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1612-1642 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3094-3124 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3130-3160 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3358-3388 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3526-3556 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3544-3574 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1144-1174 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153079-153109 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153577-153607 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153595-153625 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155881-155911 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156373-156403 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3184-3214 3 0.903
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3238-3268 3 0.903
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156319-156349 3 0.903
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3040-3070 3 0.903
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157423-157453 3 0.903
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2272-2302 3 0.903
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156301-156337 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157405-157441 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151366-151402 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153007-153043 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153871-153907 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154219-154255 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157117-157153 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1396-1432 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1594-1630 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1750-1786 3 0.919
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3022-3058 3 0.919
CP025590_1 1.25|924112|31|CP025590|CRT 924112-924142 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15526-15556 3 0.903
CP025590_1 1.25|924112|31|CP025590|CRT 924112-924142 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15652-15682 3 0.903
CP025590_1 1.25|924112|31|CP025590|CRT 924112-924142 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9571-9601 3 0.903
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151840-151870 4 0.871
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153199 4 0.871
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153613-153643 4 0.871
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156655-156685 4 0.871
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1768-1798 4 0.871
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155503-155533 4 0.871
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156283-156313 4 0.871
CP025590_1 1.26|924184|31|CP025590|CRT 924184-924214 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21139-21169 4 0.871
CP025590_1 1.26|924184|31|CP025590|CRT 924184-924214 31 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21337-21367 4 0.871
CP025590_1 1.26|924184|31|CP025590|CRT 924184-924214 31 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15940-15970 4 0.871
CP025590_1 1.26|924184|31|CP025590|CRT 924184-924214 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9697-9727 4 0.871
CP025590_1 1.26|924184|31|CP025590|CRT 924184-924214 31 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9841-9871 4 0.871
CP025590_2 2.1|2285839|26|CP025590|PILER-CR 2285839-2285864 26 AP014283 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS *** 15532-15557 4 0.846
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3670-3700 5 0.839
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2608-2638 5 0.839
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153931-153961 5 0.839
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2326-2362 5 0.865
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157714-157744 6 0.806
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1714-1744 6 0.806
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2350-2380 6 0.806
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3058-3088 6 0.806
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156715-156745 6 0.806
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156865-156895 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16070-16100 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16202-16232 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16334-16364 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16742-16772 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17360-17390 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17510-17540 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17576-17606 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17738-17768 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18092-18122 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18236-18266 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18500-18530 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18674-18704 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18824-18854 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19220-19250 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19574-19604 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19646-19676 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19718-19748 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19778-19808 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19898-19928 6 0.806
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20084-20114 6 0.806
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1768-1798 6 0.806
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154183-154219 6 0.838
CP025590_1 1.16|923458|31|CP025590|CRT 923458-923488 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3058-3088 7 0.774
CP025590_1 1.20|923722|31|CP025590|CRT 923722-923752 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1714-1744 7 0.774
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155743-155779 7 0.811
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2116-2152 7 0.811
CP025590_1 1.14|923296|31|CP025590|CRT 923296-923326 31 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 20505-20535 8 0.742
CP025590_1 1.17|923530|31|CP025590|CRT 923530-923560 31 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 20505-20535 8 0.742
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153823-153859 8 0.784
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156097-156133 8 0.784
CP025590_1 1.22|923854|37|CP025590|CRT 923854-923890 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156571-156607 8 0.784

1. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagtgattcggactcggacagc	Protospacer
*******************************

2. spacer 1.19|923662|19|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgattcggactcggacagc	CRISPR spacer
cgattcggactcggacagc	Protospacer
*******************

3. spacer 1.19|923662|19|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgattcggactcggacagc	CRISPR spacer
cgattcggactcggacagc	Protospacer
*******************

4. spacer 1.19|923662|19|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgattcggactcggacagc	CRISPR spacer
cgattcggactcggacagc	Protospacer
*******************

5. spacer 1.19|923662|19|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgattcggactcggacagc	CRISPR spacer
cgattcggactcggacagc	Protospacer
*******************

6. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactcggacagcgattcggactctgacagc	Protospacer
*************************************

7. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagcgattcggactcggacagc	Protospacer
************.******************

8. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagtgattcggactctgacagc	Protospacer
************************ ******

9. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagtgattcggactcggacagc	Protospacer
 ******************************

10. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagtgattcggactctgacagc	Protospacer
************************ ******

11. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagtgattcggactctgacagc	Protospacer
************************ ******

12. spacer 1.14|923296|31|CP025590|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.968

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagtgattcggactctgacagc	Protospacer
************************ ******

13. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattccgacagtgactccgattcggacagc	Protospacer
*********.*********************

14. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggactctgacagc	Protospacer
************ ************************

15. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggattcggacagcgattcggactctgacagc	Protospacer
*********.***************************

16. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggattcggacagcgattcggactctgacagc	Protospacer
*********.***************************

17. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattcggacagtgattcggactcggacagc	Protospacer
 ***** ************************

18. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggactcggacagc	Protospacer
 **.***************************

19. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattccgacagcgattcggactctgacagc	Protospacer
************.*********** ******

20. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgattcggactcggacagc	Protospacer
 *****.************************

21. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattcggacagtgattcggactcggacagc	Protospacer
 ***** ************************

22. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattccgacagtgactccgattcggacagt	Protospacer
*********.********************.

23. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattcggacagtgactccgattcggacagc	Protospacer
****** **.*********************

24. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggactccgacagtgactccgattcggacagc	Protospacer
***.*****.*********************

25. spacer 1.16|923458|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggactctgatagtgactccgattcggacagc	Protospacer
***.**.************************

26. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactctgacagcgattcggactctgacagc	Protospacer
.*********** ************************

27. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggattctgacagc	Protospacer
************ **************.*********

28. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgactcggattcggacagcgattcggactctgacagc	Protospacer
***.*****.***************************

29. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgattcggactccgacagc	Protospacer
************ *****************.******

30. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgattcggactccgacagc	Protospacer
************ *****************.******

31. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattccgactctgacagc	Protospacer
************ *********** ************

32. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggattctgacagcgattcggactctgacagc	Protospacer
*********.** ************************

33. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggattcggacagcgattcggactccgacagc	Protospacer
*********.********************.******

34. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggattcggacagcgattcggactccgacagc	Protospacer
*********.********************.******

35. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgattcggactccgacagc	Protospacer
************ *****************.******

36. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagc	Protospacer
************ *****************.******

37. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgattcggactccgacagc	Protospacer
************ *****************.******

38. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagc	Protospacer
************ *****************.******

39. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattccgactctgacagcgattcggactctgacagc	Protospacer
****** ***** ************************

40. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgactcggactctgacagc	Protospacer
************ ********.***************

41. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgactcggactctgacagc	Protospacer
************ ********.***************

42. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggattctgacagc	Protospacer
************ **************.*********

43. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactcggacagcgattcggattctgacagc	Protospacer
.**************************.*********

44. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgactcggactctgacagc	Protospacer
************ ********.***************

45. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattcggacagcgattcggactcggacagc	Protospacer
 ***** *****.******************

46. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattcggacagtgattcggattcggacagt	Protospacer
****** **************.********.

47. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgattcggactccgacagc	Protospacer
 *****.***************** ******

48. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgactccgacagtgattcggactctgacagt	Protospacer
***.******************** *****.

49. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagc	Protospacer
 ***********.********.*********

50. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagc	Protospacer
 ***********.********.*********

51. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagc	Protospacer
 ***********.********.*********

52. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagc	Protospacer
 ***********.********.*********

53. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagcgattcggactcggacagc	Protospacer
 *****.*****.******************

54. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgattcggactctgacagc	Protospacer
 *****.***************** ******

55. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggattcggacagc	Protospacer
 **.*****************.*********

56. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggattcggacagc	Protospacer
 **.*****************.*********

57. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagtgattcggattctgacagc	Protospacer
 ********************.** ******

58. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggattcggacagc	Protospacer
 **.*****************.*********

59. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagtgattccgactctgacagc	Protospacer
 ***************** ***** ******

60. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggattcggacagc	Protospacer
 **.*****************.*********

61. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagcgattcggactcggacagc	Protospacer
 *****.*****.******************

62. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagtgattcggattctgacagc	Protospacer
 ********************.** ******

63. spacer 1.14|923296|31|CP025590|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.903

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgattctgacagtgattcggactctgacagt	Protospacer
******.***************** *****.

64. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggactccgacagtgactccgattcggacagt	Protospacer
***.*****.********************.

65. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgattcggacagtgactccgattcggacagc	Protospacer
 ***** **.*********************

66. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattcggacagtgactccgattcggacagt	Protospacer
****** **.********************.

67. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgattcggacagtgactccgattcggacagc	Protospacer
 ***** **.*********************

68. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggactccgacagtgactccgattcggacagt	Protospacer
***.*****.********************.

69. spacer 1.16|923458|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattccgacagtgactccgattccgacagt	Protospacer
*********.************** *****.

70. spacer 1.16|923458|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgactccgacagtgactccgattcggacagc	Protospacer
 **.*****.*********************

71. spacer 1.17|923530|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

cgattcggacagtgattcagactcggatagc	CRISPR spacer
ggattcggacagtgattcggactcggacagc	Protospacer
 *****************.********.***

72. spacer 1.17|923530|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

cgattcggacagtgattcagactcggatagc	CRISPR spacer
ggattcggacagtgattcggactcggacagc	Protospacer
 *****************.********.***

73. spacer 1.20|923722|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

agactctgatagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggactcggacagc	Protospacer
.*****.**.*********************

74. spacer 1.20|923722|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

agactctgatagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgattcggactcggacagc	Protospacer
.**.*****.*********************

75. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactcggacagcgattccgactctgacagt	Protospacer
.*********************** ***********.

76. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactcggacagcgactcggactctgacagt	Protospacer
.********************.**************.

77. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactccgacagcgactcggactctgacagt	Protospacer
************ ********.**************.

78. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgactcggattcggacagcgattcggactctgacagc	Protospacer
.**.*****.***************************

79. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgactcggattcggacagcgattcggactctgacagt	Protospacer
***.*****.**************************.

80. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagt	Protospacer
************ *****************.*****.

81. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgattcggactctgacagcgattcggactccgacagt	Protospacer
************ *****************.*****.

82. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgactctgactcggacagcgattcggactctgacagt	Protospacer
***.** *****************************.

83. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggattctgacagcgattcggactctgacagc	Protospacer
.********.** ************************

84. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactctgacagcgattcggactccgacagc	Protospacer
.*********** *****************.******

85. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgattcggactcggacagcgattcggatgctgacagc	Protospacer
.**************************. ********

86. spacer 1.25|924112|31|CP025590|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ggactcagatagtgattccgactcggatagt	CRISPR spacer
agactcagatagtgattccgattcagatagt	Protospacer
.********************.**.******

87. spacer 1.25|924112|31|CP025590|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ggactcagatagtgattccgactcggatagt	CRISPR spacer
agactcagatagtgattccgattcagatagt	Protospacer
.********************.**.******

88. spacer 1.25|924112|31|CP025590|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.903

ggactcagatagtgattccgactcggatagt	CRISPR spacer
agactcagatagtgattccgattcagatagt	Protospacer
.********************.**.******

89. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagt	Protospacer
 ***********.********.********.

90. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggactccgacagt	Protospacer
 ***********.*********** *****.

91. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattccgacagcgattcggattcggacagt	Protospacer
 ***********.********.********.

92. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgattcggactccgacagt	Protospacer
 *****.***************** *****.

93. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgacagcgacagtgattcggactctgacagc	Protospacer
***.  ****************** ******

94. spacer 1.20|923722|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

agactctgatagtgattcggactcggacagc	CRISPR spacer
cgactctgacagtgattcggactccgacagt	Protospacer
 ********.************** *****.

95. spacer 1.20|923722|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

agactctgatagtgattcggactcggacagc	CRISPR spacer
cgactctgacagtgattcggactccgacagt	Protospacer
 ********.************** *****.

96. spacer 1.26|924184|31|CP025590|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.871

tgactcagacagcgactcaggttccgacaac	CRISPR spacer
agactcagacagcgactcagattcagacagc	Protospacer
 *******************.*** ****.*

97. spacer 1.26|924184|31|CP025590|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.871

tgactcagacagcgactcaggttccgacaac	CRISPR spacer
agactcagacagcgactcagattcagacagc	Protospacer
 *******************.*** ****.*

98. spacer 1.26|924184|31|CP025590|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

tgactcagacagcgactcaggttccgacaac	CRISPR spacer
agactcagacagcgactcagattcagacagc	Protospacer
 *******************.*** ****.*

99. spacer 1.26|924184|31|CP025590|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.871

tgactcagacagcgactcaggttccgacaac	CRISPR spacer
agactcagacagcgactcagattcagacagc	Protospacer
 *******************.*** ****.*

100. spacer 1.26|924184|31|CP025590|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.871

tgactcagacagcgactcaggttccgacaac	CRISPR spacer
agactcagacagcgactcagattcagacagc	Protospacer
 *******************.*** ****.*

101. spacer 2.1|2285839|26|CP025590|PILER-CR matches to AP014283 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.846

cattcaatgttccaagcccattagta	CRISPR spacer
cattaaatgttccatgcccattaaaa	Protospacer
**** ********* ********. *

102. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggactccgacagtgattcggactccgactcc	Protospacer
 **.******************** ***  *

103. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.839

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgacagcgacagtgattcggattctgacagc	Protospacer
***.  ***************.** ******

104. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

ggattccgatagtgactccgattcggacagc	CRISPR spacer
ggattccgacagtgactccgattcggattct	Protospacer
*********.*****************.  .

105. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
ggactcggactcggacagcgactcggactctgactcc	Protospacer
 **.*****************.************  *

106. spacer 1.14|923296|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

cgattccgacagtgattcggactcggacagc	CRISPR spacer
tgatgccgacagtgactcggactcggactct	Protospacer
.*** **********.************  .

107. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggatgctgacagtgattcggactcggactct	Protospacer
 *** *.*********************  .

108. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattccgacagtgattcggactcggacagc	CRISPR spacer
ggattctgacagtgactcggactcggactcg	Protospacer
 *****.********.************   

109. spacer 1.14|923296|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

cgattccgacagtgattcggactcggacagc	CRISPR spacer
cgacagcgacagtgactcggattcggacagt	Protospacer
***.  *********.*****.********.

110. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgactccgacagtgactccgattcggactct	Protospacer
 **.*****.******************  .

111. spacer 1.16|923458|31|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.806

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgactccgacagtgactccgattcggactct	Protospacer
 **.*****.******************  .

112. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

113. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

114. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

115. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactctgacagc	Protospacer
 ***   ***************** **.***

116. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

117. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

118. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

119. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactctgacagc	Protospacer
 ***   ***************** **.***

120. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

121. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

122. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactctgacagc	Protospacer
 ***   ***************** **.***

123. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

124. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

125. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactctgacagc	Protospacer
 ***   ***************** **.***

126. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

127. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagcgattcagactcagatagc	Protospacer
 ***   *****.***********.******

128. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

129. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

130. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

131. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgattcggacagtgattcagactcggatagc	CRISPR spacer
agatagcgacagtgattcagactcagacagc	Protospacer
 ***   *****************.**.***

132. spacer 1.20|923722|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.806

agactctgatagtgattcggactcggacagc	CRISPR spacer
cgacagcgacagtgattcggactctgacagc	Protospacer
 ***  .**.************** ******

133. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.838

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
tgacagtgactctgacagcgattcggactctgacagc	Protospacer
.**.   ***** ************************

134. spacer 1.16|923458|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

ggattccgatagtgactccgattcggacagc	CRISPR spacer
cgacagcgacagtgactcggattcggacagt	Protospacer
 **.  ***.******** ***********.

135. spacer 1.20|923722|31|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.774

agactctgatagtgattcggactcggacagc	CRISPR spacer
ggatgctgacagtgattcggactcggactct	Protospacer
.**. ****.******************  .

136. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.811

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgacagtgactctgacagcgattcggactccgacagt	Protospacer
***.   ***** *****************.*****.

137. spacer 1.22|923854|37|CP025590|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.811

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
cgacagtgactcggacagcgactccgactctgacagt	Protospacer
***.   **************.** ***********.

138. spacer 1.14|923296|31|CP025590|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.742

cgattccgacagtgattcggactcggacagc	CRISPR spacer
gtattccggcagtgattcagactcggtagga	Protospacer
  ******.*********.*******  .* 

139. spacer 1.17|923530|31|CP025590|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.742

cgattcggacagtgattcagactcggatagc	CRISPR spacer
gtattccggcagtgattcagactcggtagga	Protospacer
  **** *.*****************  .* 

140. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.784

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
agacagcgactccgacagcgattcggattctgacagt	Protospacer
 **.   ***** **************.********.

141. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.784

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
agacagcgactccgacagcgattcggattctgacagt	Protospacer
 **.   ***** **************.********.

142. spacer 1.22|923854|37|CP025590|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.784

cgattcggactcggacagcgattcggactctgacagc	CRISPR spacer
agacagcgactccgacagcgattcggattctgacagt	Protospacer
 **.   ***** **************.********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage