1. spacer 1.1|591560|25|CP025750|CRISPRCasFinder matches to NZ_CP032230 (Streptomyces seoulensis strain KCTC 9819 plasmid unnamed) position: , mismatch: 3, identity: 0.88
gctcactggcgccgatcagagtcag CRISPR spacer
acacacgggcgccgatcagagtcag Protospacer
.* *** ******************
2. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgagaccgcggcgaagggcagcgaa Protospacer
*********** *** ********.
3. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgagaccgcggcgaagggcagcgaa Protospacer
*********** *** ********.
4. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgcgaccgcggtgaacggcagcgtg Protospacer
** ******** *********** *
5. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgcgaccgcggtgaacggcagcgtg Protospacer
** ******** *********** *
6. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgcgaccgcggtgaacggcagcgtg Protospacer
** ******** *********** *
7. spacer 1.2|591608|25|CP025750|CRISPRCasFinder matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 3, identity: 0.88
cgagaccgcggggaacggcagcgag CRISPR spacer
cgcgaccgcggtgaacggcagcgtg Protospacer
** ******** *********** *
8. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 3, identity: 0.88
cggcgtggccggatccgacagcacc CRISPR spacer
cggcgtggccggatccaacggcatc Protospacer
****************.**.***.*
9. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88
cggcgtggccggatccgacagcacc CRISPR spacer
cggcttggccggatccgccagcagc Protospacer
**** ************ ***** *
10. spacer 1.8|591896|25|CP025750|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
ccaaaccgcgcagaacggcagcgac CRISPR spacer
cctgaccgcgcagaacggcagcgaa Protospacer
** .********************
11. spacer 1.8|591896|25|CP025750|CRISPRCasFinder matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 3, identity: 0.88
ccaaaccgcgcagaacggcagcgac CRISPR spacer
cctgaccgcgcagaacggcagcgaa Protospacer
** .********************
12. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 3, identity: 0.88
gcagacggcgcaggacggcagcgac CRISPR spacer
ggagacggtgcaggacggcagctac Protospacer
* ******.************* **
13. spacer 1.14|592184|25|CP025750|CRISPRCasFinder matches to NC_015851 (Acidithiobacillus caldus SM-1 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88
ccaaaccgcccgtaccggcagcgac CRISPR spacer
ccaaaccgcccataccggcaccgat Protospacer
***********.******** ***.
14. spacer 1.14|592184|25|CP025750|CRISPRCasFinder matches to NZ_CP026329 (Acidithiobacillus caldus strain MTH-04 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
ccaaaccgcccgtaccggcagcgac CRISPR spacer
ccaaaccgcccataccggcaccgat Protospacer
***********.******** ***.
15. spacer 1.14|592184|25|CP025750|CRISPRCasFinder matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 3, identity: 0.88
ccaaaccgcccgtaccggcagcgac CRISPR spacer
ccaaaccgcccataccggcaccgat Protospacer
***********.******** ***.
16. spacer 1.15|592232|25|CP025750|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 3, identity: 0.88
ctccaccgctggtgcggacagcacg CRISPR spacer
ccccgccgctggtgcggacatcacg Protospacer
*.**.*************** ****
17. spacer 1.15|592232|25|CP025750|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 3, identity: 0.88
ctccaccgctggtgcggacagcacg CRISPR spacer
cgccaccgctggggcggacagcccg Protospacer
* ********** ********* **
18. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctcgaccggcggctcggacagcact Protospacer
******** **** **********.
19. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctcgaccggcggcgcggacagcgac Protospacer
******** *************. *
20. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 3, identity: 0.88
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctcgaccgccggcgccgccagcaac Protospacer
*************** * ***** *
21. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_CP005088 (Sphingobium sp. TKS plasmid pTK4, complete sequence) position: , mismatch: 3, identity: 0.88
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctcgaccgccggcgccgccagcaac Protospacer
*************** * ***** *
22. spacer 1.21|592520|25|CP025750|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 3, identity: 0.88
ctcgaccgccggtgcggacagcacc CRISPR spacer
cccgaccgccggtgcggacagccgc Protospacer
*.******************** *
23. spacer 1.1|591560|25|CP025750|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.84
gctcactggcgccgatcagagtcag CRISPR spacer
gctcgctggcgccgaccagagtctc Protospacer
****.**********.*******
24. spacer 1.1|591560|25|CP025750|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.84
gctcactggcgccgatcagagtcag CRISPR spacer
gctcgctggcgccgaccagagtctc Protospacer
****.**********.*******
25. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
cggcgtggccggatccgacagcacc CRISPR spacer
cggcgtggccggatcggacagccgg Protospacer
*************** ******
26. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84
cggcgtggccggatccgacagcacc CRISPR spacer
cggcgtggccggatcggacagccgg Protospacer
*************** ******
27. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 4, identity: 0.84
cggcgtggccggatccgacagcacc CRISPR spacer
cggcgtggccggatcggacagccgg Protospacer
*************** ******
28. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to MN204501 (Gordonia phage Chikenjars, complete genome) position: , mismatch: 4, identity: 0.84
cggcgtggccggatccgacagcacc CRISPR spacer
gtgcgtggcaggatccaacagcacc Protospacer
******* ******.********
29. spacer 1.3|591656|25|CP025750|CRISPRCasFinder matches to NC_048793 (Gordonia phage Kenosha, complete genome) position: , mismatch: 4, identity: 0.84
cggcgtggccggatccgacagcacc CRISPR spacer
gtgcgtggcgggatccaacagcacc Protospacer
******* ******.********
30. spacer 1.5|591752|25|CP025750|CRISPRCasFinder matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 4, identity: 0.84
acagaccgcccgcaatggcagcgag CRISPR spacer
gctgaccgcccgcgatggcagcgat Protospacer
.* **********.**********
31. spacer 1.5|591752|25|CP025750|CRISPRCasFinder matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
acagaccgcccgcaatggcagcgag CRISPR spacer
gctgaccgcccgcgatggcagcgat Protospacer
.* **********.**********
32. spacer 1.6|591800|25|CP025750|CRISPRCasFinder matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.84
ggaaaccgccggtgcagacagctcg CRISPR spacer
cagaaccgccggtgcagacaggtcg Protospacer
..****************** ***
33. spacer 1.9|591944|25|CP025750|CRISPRCasFinder matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.84
cagcacggcgggcaccgatagctcg CRISPR spacer
cggcgcggcgggcaccgatagctgc Protospacer
*.**.******************
34. spacer 1.9|591944|25|CP025750|CRISPRCasFinder matches to NC_008538 (Arthrobacter sp. FB24 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.84
cagcacggcgggcaccgatagctcg CRISPR spacer
cggcgcggcgggcaccgatagctgc Protospacer
*.**.******************
35. spacer 1.9|591944|25|CP025750|CRISPRCasFinder matches to NC_008539 (Arthrobacter sp. FB24 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.84
cagcacggcgggcaccgatagctcg CRISPR spacer
cggcgcggcgggcaccgatagctgc Protospacer
*.**.******************
36. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
cgagacggcgcaggaccgcagcgcc Protospacer
************** ****** *
37. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
cgagacggcgccggacggcagcgcc Protospacer
********* *********** *
38. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
ccagacggcgcaggacgtcggcgag Protospacer
**************** *.****
39. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
gcaggcggcgcaggacggcaggatc Protospacer
****.**************** . *
40. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP035035 (Pantoea ananatis strain NN08200 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
gcagacggcccagcacggcagcgga Protospacer
********* *** *********.
41. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
ccagacggcgcaggacgtcggcgag Protospacer
**************** *.****
42. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
cgagccggcgcaggacggcatcgac Protospacer
** *************** ****
43. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP045095 (Streptomyces sp. GY16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
gaggacggcgcaggacgccagcgag Protospacer
* .************** ******
44. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
cgagacggcgcaggaccgcagcgcc Protospacer
************** ****** *
45. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
ccagacggcgcaggacgtcggcgag Protospacer
**************** *.****
46. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
gcagacggcgcaggacggcagcgac CRISPR spacer
ccagacggcgcaggacgtcggcgag Protospacer
**************** *.****
47. spacer 1.13|592136|25|CP025750|CRISPRCasFinder matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 4, identity: 0.84
gcagacatccggcaacgacagctcg CRISPR spacer
cgagacatccggcatcgacaggtcg Protospacer
************ ****** ***
48. spacer 1.17|592328|25|CP025750|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.84
ccaaaccgcgcgcaagggtagcgac CRISPR spacer
tgaaaacgcgcgcaagggtagcgtc Protospacer
. *** ***************** *
49. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ctcgaccgccggcgcggacagcacc CRISPR spacer
cagcaccgccgacgcggacagcacc Protospacer
* *******.*************
50. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctcgaccggcggcgcggacagggac Protospacer
******** ************ . *
51. spacer 1.18|592376|25|CP025750|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 4, identity: 0.84
ctcgaccgccggcgcggacagcacc CRISPR spacer
ctccatcgccggcgcggacagcaaa Protospacer
*** *.*****************
52. spacer 1.21|592520|25|CP025750|CRISPRCasFinder matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 4, identity: 0.84
ctcgaccgccggtgcggacagcacc CRISPR spacer
ggcgaccgcctgtgcggccagcacc Protospacer
******** ****** *******
53. spacer 1.21|592520|25|CP025750|CRISPRCasFinder matches to NZ_CP021815 (Sinorhizobium meliloti strain M270 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.84
ctcgaccgccggtgcggacagcacc CRISPR spacer
cacgaccgccggtgcggacagacct Protospacer
* ******************* *.
54. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.8
gcagacggcgcaggacggcagcgac CRISPR spacer
cgcgacggcgcaggacggcagcaag Protospacer
*******************.*
55. spacer 1.11|592040|25|CP025750|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 5, identity: 0.8
gcagacggcgcaggacggcagcgac CRISPR spacer
cgagacggcgcaggaccgcagcgct Protospacer
************** ****** .
56. spacer 1.14|592184|25|CP025750|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.8
ccaaaccgcccgtaccggcagcgac CRISPR spacer
aggaaccgcccgtaccggcagcccc Protospacer
.******************* *
57. spacer 1.14|592184|25|CP025750|CRISPRCasFinder matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 5, identity: 0.8
ccaaaccgcccgtaccggcagcgac CRISPR spacer
ggaatccgcccgtaccggcagcgtt Protospacer
** ****************** .
58. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to NZ_KY296095 (Pseudomonas aeruginosa strain 14057 plasmid p14057-KPC, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
59. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to MK882885 (Pseudomonas aeruginosa plasmid YLH6_p3, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
60. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to NZ_CP024631 (Pseudomonas aeruginosa strain PA59 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
61. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to NZ_CP020561 (Pseudomonas aeruginosa strain CR1 plasmid pCR1, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
62. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to NZ_MN433456 (Pseudomonas aeruginosa strain PAB546 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
63. spacer 1.16|592280|25|CP025750|CRISPRCasFinder matches to NZ_MH734334 (Pseudomonas aeruginosa strain 1011 plasmid p1011-KPC2, complete sequence) position: , mismatch: 5, identity: 0.8
ccagacttccggcggggacagttcg CRISPR spacer
gtgcacttccggcggggccagttcg Protospacer
.. ************* *******
64. spacer 1.21|592520|25|CP025750|CRISPRCasFinder matches to NZ_CP025015 (Rhizobium leguminosarum strain Norway plasmid pRLN3, complete sequence) position: , mismatch: 5, identity: 0.8
ctcgaccgccggtgcggacagcacc CRISPR spacer
aaagaccgccggtgcggacagaact Protospacer
****************** **.
