Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 0 crisprs RT,csa3,PD-DExK 0 0 1 0
CP026194 Enterobacteriaceae bacterium ENNIH1 plasmid pKPC-825d, complete sequence 0 crisprs DEDDh 0 0 1 0
CP026195 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-82e8, complete sequence 0 crisprs NA 0 0 1 0
CP026193 Enterobacteriaceae bacterium ENNIH1 chromosome, complete genome 4 crisprs WYL,DinG,RT,DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 1 32 9 0

Results visualization

1. CP026196
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38530 : 108035 73 Escherichia_phage(15.0%) integrase,transposase attL 69051:69064|attR 109555:109568

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026194
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7132 : 32128 22 Escherichia_phage(41.67%) integrase,protease,transposase attL 24683:24742|attR 25992:26133

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP026195
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15063 15 Salmonella_phage(28.57%) integrase,transposase attL 1:60|attR 8494:9068

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP026193
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026193_1 1622598-1622727 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026193_2 4933262-4934387 TypeI-E I-E
18 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026193_3 4943328-4944210 TypeI-E I-E
14 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026193_4 4949508-4950268 TypeI-E I-E
12 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026193_3 3.8|4943784|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943784-4943815 32 CP026193.1 407574-407605 2 0.938

1. spacer 3.8|4943784|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to position: 407574-407605, mismatch: 2, identity: 0.938 

gcgccgttggggtaagacataatcccctcttg	CRISPR spacer
gcaccgttgggataagacataatcccctcttg	Protospacer
**.********.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026193_4 4.7|4949903|32|CP026193|CRISPRCasFinder,CRT 4949903-4949934 32 NC_025443 Salmonella phage 9NA, complete genome 48035-48066 2 0.938
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 NC_004775 Enterobacteria phage epsilon15, complete genome 35073-35104 3 0.906
CP026193_4 4.18|4949903|33|CP026193|PILER-CR 4949903-4949935 33 NC_025443 Salmonella phage 9NA, complete genome 48034-48066 3 0.909
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 EU272037 Pseudomonas phage MP38, complete genome 11739-11769 4 0.871
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 9906-9937 4 0.875
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 2198-2229 4 0.875
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 KY271395 Klebsiella phage 2b LV-2017, complete genome 2410-2441 4 0.875
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 2198-2229 4 0.875
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 26771-26801 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 27202-27232 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 26202-26232 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 26041-26071 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 25519-25549 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 AY394005 Bacteriophage D3112, complete genome 11729-11759 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 JN811560 Pseudomonas phage JBD26, complete genome 11732-11762 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389337 UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence 9415-9445 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 JQ762257 Pseudomonas phage MP42, complete genome 11647-11677 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 11134-11164 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 JQ067085 Pseudomonas phage PaMx73, complete genome 10446-10476 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 11233-11263 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 11518-11548 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KJ477077 Pseudomonas phage JD024, complete genome 10593-10623 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 JX434030 Pseudomonas phage JBD5, complete genome 11515-11545 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NC_030918 Pseudomonas phage JBD93, complete genome 11135-11165 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NC_005178 Pseudomonas phage D3112, complete genome 11729-11759 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 11172-11202 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 8484-8514 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 JX434032 Pseudomonas phage JBD30, complete genome 11686-11716 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 KU199708 Pseudomonas phage JBD69, complete genome 11669-11699 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 DQ631426 Pseudomonas phage DMS3, complete genome 11242-11272 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NC_024782 Pseudomonas phage MP48, complete genome 11097-11127 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 EU272036 Pseudomonas phage MP29, complete genome 11097-11127 5 0.839
CP026193_2 2.1|4933291|31|CP026193|CRT 4933291-4933321 31 NZ_LR594663 Variovorax sp. RA8 plasmid 2 47639-47669 5 0.839
CP026193_2 2.11|4933900|32|CP026193|CRT,CRISPRCasFinder 4933900-4933931 32 NZ_CP049247 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence 42038-42069 5 0.844
CP026193_2 2.11|4933900|32|CP026193|CRT,CRISPRCasFinder 4933900-4933931 32 NZ_CP049252 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence 24489-24520 5 0.844
CP026193_2 2.24|4933903|32|CP026193|PILER-CR 4933903-4933934 32 NZ_CP049247 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence 42038-42069 5 0.844
CP026193_2 2.24|4933903|32|CP026193|PILER-CR 4933903-4933934 32 NZ_CP049252 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence 24489-24520 5 0.844
CP026193_3 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943967-4943998 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 41116-41147 5 0.844
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 MH791412 UNVERIFIED: Salmonella phage SeSz-2, complete genome 22366-22397 6 0.812
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 MK599416 Salmonella phage Akira, complete genome 33842-33873 6 0.812
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 MH791410 UNVERIFIED: Salmonella phage Seszw_1, complete genome 44382-44413 6 0.812
CP026193_2 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder 4933961-4933992 32 MH321490 Staphylococcus phage Quidividi, complete genome 13024-13055 7 0.781
CP026193_2 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder 4933961-4933992 32 MH321491 Staphylococcus phage Twillingate, complete genome 14549-14580 7 0.781
CP026193_2 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder 4934205-4934236 32 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 2408-2439 7 0.781
CP026193_2 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder 4934205-4934236 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 29544-29575 7 0.781
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_KY362373 Pseudomonas syringae pv. syringae strain 7B44 plasmid pPs7B44, complete sequence 30122-30153 7 0.781
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_KY362372 Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence 25135-25166 7 0.781
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_CP026559 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence 117878-117909 7 0.781
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_LT963405 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence 61112-61143 7 0.781
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_CP026564 Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence 72152-72183 7 0.781
CP026193_2 2.25|4933964|32|CP026193|PILER-CR 4933964-4933995 32 MH321490 Staphylococcus phage Quidividi, complete genome 13024-13055 7 0.781
CP026193_2 2.25|4933964|32|CP026193|PILER-CR 4933964-4933995 32 MH321491 Staphylococcus phage Twillingate, complete genome 14549-14580 7 0.781
CP026193_2 2.29|4934208|32|CP026193|PILER-CR 4934208-4934239 32 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 2408-2439 7 0.781
CP026193_2 2.29|4934208|32|CP026193|PILER-CR 4934208-4934239 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 29544-29575 7 0.781
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_KY362373 Pseudomonas syringae pv. syringae strain 7B44 plasmid pPs7B44, complete sequence 30122-30153 7 0.781
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_KY362372 Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence 25135-25166 7 0.781
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_CP026559 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence 117878-117909 7 0.781
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_LT963405 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence 61112-61143 7 0.781
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_CP026564 Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence 72152-72183 7 0.781
CP026193_3 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944150-4944181 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 137115-137146 7 0.781
CP026193_3 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944150-4944181 32 NZ_CP006570 Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence 321871-321902 7 0.781
CP026193_2 2.6|4933595|32|CP026193|CRT,CRISPRCasFinder 4933595-4933626 32 NC_025830 Escherichia phage Av-05, complete genome 34104-34135 8 0.75
CP026193_2 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder 4933961-4933992 32 MF417868 Uncultured Caudovirales phage clone 7AX_1, partial genome 26451-26482 8 0.75
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 574838-574869 8 0.75
CP026193_2 2.25|4933964|32|CP026193|PILER-CR 4933964-4933995 32 MF417868 Uncultured Caudovirales phage clone 7AX_1, partial genome 26451-26482 8 0.75
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 574838-574869 8 0.75
CP026193_3 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943418-4943449 32 NZ_CP028876 Borreliella bavariensis PBi plasmid lp17, complete sequence 12326-12357 8 0.75
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1076911-1076942 8 0.75
CP026193_4 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT 4949659-4949690 32 BK010646 TPA_exp: Bacteroides phage p00, complete sequence 28287-28318 8 0.75
CP026193_4 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT 4949659-4949690 32 JQ680363 Unidentified phage clone 2020_scaffold1264 genomic sequence 14489-14520 8 0.75
CP026193_4 4.8|4949964|32|CP026193|CRISPRCasFinder,CRT 4949964-4949995 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 61794-61825 8 0.75
CP026193_4 4.11|4950147|32|CP026193|CRISPRCasFinder,CRT 4950147-4950178 32 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 137620-137651 8 0.75
CP026193_2 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder 4933656-4933687 32 MN693397 Marine virus AFVG_25M279, complete genome 30366-30397 9 0.719
CP026193_2 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder 4933656-4933687 32 MN693087 Marine virus AFVG_25M280, complete genome 28373-28404 9 0.719
CP026193_2 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder 4933656-4933687 32 MN693388 Marine virus AFVG_25M277, complete genome 6677-6708 9 0.719
CP026193_2 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder 4933656-4933687 32 MN693389 Marine virus AFVG_25M278, complete genome 4205-4236 9 0.719
CP026193_2 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder 4934205-4934236 32 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 111082-111113 9 0.719
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 99845-99876 9 0.719
CP026193_2 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder 4934327-4934358 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 347192-347223 9 0.719
CP026193_2 2.20|4933659|32|CP026193|PILER-CR 4933659-4933690 32 MN693397 Marine virus AFVG_25M279, complete genome 30366-30397 9 0.719
CP026193_2 2.20|4933659|32|CP026193|PILER-CR 4933659-4933690 32 MN693087 Marine virus AFVG_25M280, complete genome 28373-28404 9 0.719
CP026193_2 2.20|4933659|32|CP026193|PILER-CR 4933659-4933690 32 MN693388 Marine virus AFVG_25M277, complete genome 6677-6708 9 0.719
CP026193_2 2.20|4933659|32|CP026193|PILER-CR 4933659-4933690 32 MN693389 Marine virus AFVG_25M278, complete genome 4205-4236 9 0.719
CP026193_2 2.29|4934208|32|CP026193|PILER-CR 4934208-4934239 32 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 111082-111113 9 0.719
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 99845-99876 9 0.719
CP026193_2 2.31|4934330|32|CP026193|PILER-CR 4934330-4934361 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 347192-347223 9 0.719
CP026193_3 3.1|4943357|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943357-4943388 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 551639-551670 9 0.719
CP026193_3 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943418-4943449 32 MT074138 Bacteroides phage DAC17, complete genome 47303-47334 9 0.719
CP026193_3 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943418-4943449 32 MT074136 Bacteroides phage DAC15, complete genome 48968-48999 9 0.719
CP026193_3 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943601-4943632 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2120536-2120567 9 0.719
CP026193_3 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943601-4943632 32 KP790010 Gordonia phage GordDuk1, complete genome 15682-15713 9 0.719
CP026193_3 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943601-4943632 32 KP790009 Gordonia phage Gmala1, complete genome 15742-15773 9 0.719
CP026193_3 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944150-4944181 32 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 114218-114249 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MH834599 Microbacterium phage Bernstein, complete genome 20213-20244 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MH834602 Microbacterium phage Brahms, complete genome 20160-20191 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MN183281 Microbacterium phage Vitas, complete genome 20153-20184 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MH834626 Microbacterium phage Rollins, complete genome 20213-20244 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MH834604 Microbacterium phage Coltrane, complete genome 20160-20191 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MH834596 Microbacterium phage Armstrong, complete genome 20158-20189 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MK279874 Arthrobacter phage Riovina, complete genome 35529-35560 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MK279851 Arthrobacter phage Eunoia, complete genome 35529-35560 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MK112526 Arthrobacter phage Aledel, complete genome 35529-35560 9 0.719
CP026193_4 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT 4949598-4949629 32 MK279868 Arthrobacter phage OMalley, complete genome 35529-35560 9 0.719
CP026193_4 4.6|4949842|32|CP026193|CRISPRCasFinder,CRT 4949842-4949873 32 MN850588 Escherichia phage sortregn, complete genome 2154-2185 9 0.719
CP026193_4 4.11|4950147|32|CP026193|CRISPRCasFinder,CRT 4950147-4950178 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 73573-73604 9 0.719
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1076911-1076943 9 0.727
CP026193_2 2.2|4933351|32|CP026193|CRT,PILER-CR,CRISPRCasFinder 4933351-4933382 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 267896-267927 10 0.688
CP026193_2 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder 4933717-4933748 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1779941-1779972 10 0.688
CP026193_2 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder 4933717-4933748 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 65370-65401 10 0.688
CP026193_2 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder 4933717-4933748 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 392837-392868 10 0.688
CP026193_2 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder 4934205-4934236 32 MN840485 Escherichia phage 2725-N35, complete genome 34787-34818 10 0.688
CP026193_2 2.21|4933720|32|CP026193|PILER-CR 4933720-4933751 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1779941-1779972 10 0.688
CP026193_2 2.21|4933720|32|CP026193|PILER-CR 4933720-4933751 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 65370-65401 10 0.688
CP026193_2 2.21|4933720|32|CP026193|PILER-CR 4933720-4933751 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 392837-392868 10 0.688
CP026193_2 2.29|4934208|32|CP026193|PILER-CR 4934208-4934239 32 MN840485 Escherichia phage 2725-N35, complete genome 34787-34818 10 0.688
CP026193_3 3.1|4943357|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943357-4943388 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 33494-33525 10 0.688
CP026193_3 3.4|4943540|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943540-4943571 32 NZ_KU306397 Corynebacterium glutamicum strain DSM 1412 plasmid pBL90, complete sequence 51937-51968 10 0.688
CP026193_3 3.7|4943723|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4943723-4943754 32 MF417867 Uncultured Caudovirales phage clone 3F_7, partial genome 19083-19114 10 0.688
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 NZ_CP046399 Bacillus sp. A260 plasmid unnamed11, complete sequence 69169-69200 10 0.688
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 NZ_CP031066 Bacillus sp. SH8-8 plasmid pl193, complete sequence 146518-146549 10 0.688
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 NZ_CP031063 Bacillus sp. AR4-2 plasmid pl192, complete sequence 146519-146550 10 0.688
CP026193_3 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944028-4944059 32 NZ_CP018742 Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence 179771-179802 10 0.688
CP026193_3 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944089-4944120 32 NZ_CP022220 Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence 886412-886443 10 0.688
CP026193_3 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944089-4944120 32 NZ_CP030052 Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence 499252-499283 10 0.688
CP026193_3 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944089-4944120 32 NZ_CP030054 Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence 678845-678876 10 0.688
CP026193_4 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT 4949659-4949690 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 554273-554304 10 0.688
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MH834599 Microbacterium phage Bernstein, complete genome 20212-20244 10 0.697
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MH834602 Microbacterium phage Brahms, complete genome 20159-20191 10 0.697
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MN183281 Microbacterium phage Vitas, complete genome 20152-20184 10 0.697
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MH834626 Microbacterium phage Rollins, complete genome 20212-20244 10 0.697
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MH834604 Microbacterium phage Coltrane, complete genome 20159-20191 10 0.697
CP026193_4 4.13|4949598|33|CP026193|PILER-CR 4949598-4949630 33 MH834596 Microbacterium phage Armstrong, complete genome 20157-20189 10 0.697
CP026193_3 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT 4944150-4944181 32 NZ_CP014353 Acidipropionibacterium acidipropionici strain ATCC 55737 plasmid unnamed, complete sequence 1361-1392 11 0.656

1. spacer 4.7|4949903|32|CP026193|CRISPRCasFinder,CRT matches to NC_025443 (Salmonella phage 9NA, complete genome) position: , mismatch: 2, identity: 0.938 

atacgacctggtaaacgtccattccatgcacc	CRISPR spacer
atacggcctggtaaacgtccgttccatgcacc	Protospacer
*****.**************.***********

2. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 3, identity: 0.906 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcgtcggccga	Protospacer
*******************.********  **

3. spacer 4.18|4949903|33|CP026193|PILER-CR matches to NC_025443 (Salmonella phage 9NA, complete genome) position: , mismatch: 3, identity: 0.909 

atacgacctggtaaacgtccattccatgcaccc	CRISPR spacer
atacggcctggtaaacgtccgttccatgcacct	Protospacer
*****.**************.***********.

4. spacer 2.1|4933291|31|CP026193|CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 4, identity: 0.871 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggatggcgccca	Protospacer
**  .********.*****************

5. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.875 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcgtcggccgc	Protospacer
*******************.********  *

6. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 4, identity: 0.875 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcgtcggccgc	Protospacer
*******************.********  *

7. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 4, identity: 0.875 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcgtcggccgc	Protospacer
*******************.********  *

8. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 4, identity: 0.875 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcgtcggccgc	Protospacer
*******************.********  *

9. spacer 2.1|4933291|31|CP026193|CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

10. spacer 2.1|4933291|31|CP026193|CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

11. spacer 2.1|4933291|31|CP026193|CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgttgttttcgttggacggcgccca	Protospacer
**  .****.************.********

12. spacer 2.1|4933291|31|CP026193|CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

13. spacer 2.1|4933291|31|CP026193|CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

14. spacer 2.1|4933291|31|CP026193|CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

15. spacer 2.1|4933291|31|CP026193|CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

16. spacer 2.1|4933291|31|CP026193|CRT matches to KM389337 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

17. spacer 2.1|4933291|31|CP026193|CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

18. spacer 2.1|4933291|31|CP026193|CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

19. spacer 2.1|4933291|31|CP026193|CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

20. spacer 2.1|4933291|31|CP026193|CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

21. spacer 2.1|4933291|31|CP026193|CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

22. spacer 2.1|4933291|31|CP026193|CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

23. spacer 2.1|4933291|31|CP026193|CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

24. spacer 2.1|4933291|31|CP026193|CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgttgttttcgttggacggcgccca	Protospacer
**  .****.************.********

25. spacer 2.1|4933291|31|CP026193|CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

26. spacer 2.1|4933291|31|CP026193|CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgttgttttcgttggacggcgccca	Protospacer
**  .****.************.********

27. spacer 2.1|4933291|31|CP026193|CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

28. spacer 2.1|4933291|31|CP026193|CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

29. spacer 2.1|4933291|31|CP026193|CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

30. spacer 2.1|4933291|31|CP026193|CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

31. spacer 2.1|4933291|31|CP026193|CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

32. spacer 2.1|4933291|31|CP026193|CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggatggcgccca	CRISPR spacer
cgcgggtgtcgttctcgttggacggcgccca	Protospacer
**  .********.********.********

33. spacer 2.1|4933291|31|CP026193|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 5, identity: 0.839 

cggcagtgtcgttttcgttggat--ggcgccca	CRISPR spacer
cggcagtgtcgttttcgtgggatccatcgcc--	Protospacer
****************** ****  . ****

34. spacer 2.11|4933900|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP049247 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

aatatcaatcatcaggtcacgcattacatatc	CRISPR spacer
aatatcaatcatcaggtcacgcattagcgtcc	Protospacer
**************************    .*

35. spacer 2.11|4933900|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP049252 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844 

aatatcaatcatcaggtcacgcattacatatc	CRISPR spacer
aatatcaatcatcaggtcacgcattagcgtcc	Protospacer
**************************    .*

36. spacer 2.24|4933903|32|CP026193|PILER-CR matches to NZ_CP049247 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

aatatcaatcatcaggtcacgcattacatatc	CRISPR spacer
aatatcaatcatcaggtcacgcattagcgtcc	Protospacer
**************************    .*

37. spacer 2.24|4933903|32|CP026193|PILER-CR matches to NZ_CP049252 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844 

aatatcaatcatcaggtcacgcattacatatc	CRISPR spacer
aatatcaatcatcaggtcacgcattagcgtcc	Protospacer
**************************    .*

38. spacer 3.11|4943967|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 5, identity: 0.844 

caagagtggcaagcagcaatcgcgtcggaaga	CRISPR spacer
caagagtggcaagcagcaaccgcttcggccgc	Protospacer
*******************.*** ****  *

39. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MH791412 (UNVERIFIED: Salmonella phage SeSz-2, complete genome) position: , mismatch: 6, identity: 0.812 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
aaaggattgatgctgcgcgtaatgatgctgtc	Protospacer
. **********  ***************.*

40. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MK599416 (Salmonella phage Akira, complete genome) position: , mismatch: 6, identity: 0.812 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
aaaggattgatgctgcgcgtaatgatgctgtc	Protospacer
. **********  ***************.*

41. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MH791410 (UNVERIFIED: Salmonella phage Seszw_1, complete genome) position: , mismatch: 6, identity: 0.812 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
aaaggattgatgctgcgcgtaatgatgctgtt	Protospacer
. **********  ***************.*

42. spacer 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder matches to MH321490 (Staphylococcus phage Quidividi, complete genome) position: , mismatch: 7, identity: 0.781 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggatga--atatcaaaatgtgaataaacatgata	Protospacer
  ****   ***** ******** ********..

43. spacer 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder matches to MH321491 (Staphylococcus phage Twillingate, complete genome) position: , mismatch: 7, identity: 0.781 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggatga--atatcaaaatgtgaataaacatgata	Protospacer
  ****   ***** ******** ********..

44. spacer 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 7, identity: 0.781 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
tcggccgcaggcgcccaggtgctgacgatatc	Protospacer
** * .* .****************..*****

45. spacer 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 7, identity: 0.781 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
tcggccgcaggcgcccaggtgctgacgatatc	Protospacer
** * .* .****************..*****

46. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_KY362373 (Pseudomonas syringae pv. syringae strain 7B44 plasmid pPs7B44, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

47. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_KY362372 (Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

48. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

49. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_LT963405 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

50. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP026564 (Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

51. spacer 2.25|4933964|32|CP026193|PILER-CR matches to MH321490 (Staphylococcus phage Quidividi, complete genome) position: , mismatch: 7, identity: 0.781 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggatga--atatcaaaatgtgaataaacatgata	Protospacer
  ****   ***** ******** ********..

52. spacer 2.25|4933964|32|CP026193|PILER-CR matches to MH321491 (Staphylococcus phage Twillingate, complete genome) position: , mismatch: 7, identity: 0.781 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggatga--atatcaaaatgtgaataaacatgata	Protospacer
  ****   ***** ******** ********..

53. spacer 2.29|4934208|32|CP026193|PILER-CR matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 7, identity: 0.781 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
tcggccgcaggcgcccaggtgctgacgatatc	Protospacer
** * .* .****************..*****

54. spacer 2.29|4934208|32|CP026193|PILER-CR matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 7, identity: 0.781 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
tcggccgcaggcgcccaggtgctgacgatatc	Protospacer
** * .* .****************..*****

55. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_KY362373 (Pseudomonas syringae pv. syringae strain 7B44 plasmid pPs7B44, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

56. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_KY362372 (Pseudomonas syringae pv. syringae strain UMAF0170 plasmid pPs0170, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

57. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_CP026559 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p2_tig3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

58. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_LT963405 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP3, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

59. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_CP026564 (Pseudomonas avellanae strain R2leaf plasmid p2_tig5, complete sequence) position: , mismatch: 7, identity: 0.781 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
cgcatttcctcggcggtgccgaccatcccgtc	Protospacer
***   ************ ** ******* *.

60. spacer 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcgccggacctggcgcaggaaatttgattac	CRISPR spacer
cgcgccgaagctggcgcaggaaattcgcgtcc	Protospacer
.******.* ***************.*  * *

61. spacer 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006570 (Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence) position: , mismatch: 7, identity: 0.781 

tgcgccggacctggcgcaggaaatttgattac	CRISPR spacer
agcgccggacctggcgccggcaataaccttac	Protospacer
 **************** ** ***    ****

62. spacer 2.6|4933595|32|CP026193|CRT,CRISPRCasFinder matches to NC_025830 (Escherichia phage Av-05, complete genome) position: , mismatch: 8, identity: 0.75 

ccaggaccatgcagtttttggtgatctcacca	CRISPR spacer
ccagccccatgcagtttttggtgcatatacct	Protospacer
****  *****************  . .***

63. spacer 2.12|4933961|32|CP026193|CRT,CRISPRCasFinder matches to MF417868 (Uncultured Caudovirales phage clone 7AX_1, partial genome) position: , mismatch: 8, identity: 0.75 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggataa--atatcaaaatgtgaataaacatgata	Protospacer
  **.*   ***** ******** ********..

64. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
agctgatcatcggcggtggcgtccagaccggc	Protospacer
 ***.*** ****************  **  .

65. spacer 2.25|4933964|32|CP026193|PILER-CR matches to MF417868 (Uncultured Caudovirales phage clone 7AX_1, partial genome) position: , mismatch: 8, identity: 0.75 

--atgattctatcacaatgtgaagaaacatgacg	CRISPR spacer
ggataa--atatcaaaatgtgaataaacatgata	Protospacer
  **.*   ***** ******** ********..

66. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
agctgatcatcggcggtggcgtccagaccggc	Protospacer
 ***.*** ****************  **  .

67. spacer 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028876 (Borreliella bavariensis PBi plasmid lp17, complete sequence) position: , mismatch: 8, identity: 0.75 

gcagaaacaggaggagatgactttgttattaa	CRISPR spacer
gaaattataggtggagatgaatttgttattat	Protospacer
* *.  *.*** ******** **********

68. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
ctggtggctccttgcggtattcgcggcgcttg	Protospacer
   * .************  ***********.

69. spacer 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT matches to BK010646 (TPA_exp: Bacteroides phage p00, complete sequence) position: , mismatch: 8, identity: 0.75 

tcctctccttcacgatctattatttcacggag	CRISPR spacer
gcaaccctttcacggtctattatttcagggac	Protospacer
 *  *.*.******.************ ***

70. spacer 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT matches to JQ680363 (Unidentified phage clone 2020_scaffold1264 genomic sequence) position: , mismatch: 8, identity: 0.75 

tcctctccttcacgatctattatttcacggag	CRISPR spacer
gcaaccctttcacggtctattatttcagggac	Protospacer
 *  *.*.******.************ ***

71. spacer 4.8|4949964|32|CP026193|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

atctgctcagcagccagcgccagtaa----ctggga	CRISPR spacer
ttctgttcagcagccagcgcccgtgaggttct----	Protospacer
 ****.*************** **.*    **

72. spacer 4.11|4950147|32|CP026193|CRISPRCasFinder,CRT matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 8, identity: 0.75 

attctgacttcgcttttcatcagtaccggaac	CRISPR spacer
agcggggcctcgcttttcatcaatatcggaac	Protospacer
* .  *.*.*************.**.******

73. spacer 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder matches to MN693397 (Marine virus AFVG_25M279, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

74. spacer 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder matches to MN693087 (Marine virus AFVG_25M280, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

75. spacer 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder matches to MN693388 (Marine virus AFVG_25M277, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

76. spacer 2.7|4933656|32|CP026193|CRT,CRISPRCasFinder matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

77. spacer 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.719 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
gacgatgcggccgcccaggtgctgataagggt	Protospacer
  .**** ** ***************** . .

78. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
aacagttcctcggcgatggcgtccagcccata	Protospacer
 .* . *********.********* *** *

79. spacer 2.18|4934327|32|CP026193|CRT,CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
aacagttcctcggcgatggcgtccagcccata	Protospacer
 .* . *********.********* *** *

80. spacer 2.20|4933659|32|CP026193|PILER-CR matches to MN693397 (Marine virus AFVG_25M279, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

81. spacer 2.20|4933659|32|CP026193|PILER-CR matches to MN693087 (Marine virus AFVG_25M280, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

82. spacer 2.20|4933659|32|CP026193|PILER-CR matches to MN693388 (Marine virus AFVG_25M277, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

83. spacer 2.20|4933659|32|CP026193|PILER-CR matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 9, identity: 0.719 

aggggctggcacttcgggtaattccgtgacgc	CRISPR spacer
tgggtctggcactttgggtaattctggagggt	Protospacer
 *** *********.*********.* .. *.

84. spacer 2.29|4934208|32|CP026193|PILER-CR matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.719 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
gacgatgcggccgcccaggtgctgataagggt	Protospacer
  .**** ** ***************** . .

85. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
aacagttcctcggcgatggcgtccagcccata	Protospacer
 .* . *********.********* *** *

86. spacer 2.31|4934330|32|CP026193|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

cgctaatcctcggcggtggcgtccatcccttt	CRISPR spacer
aacagttcctcggcgatggcgtccagcccata	Protospacer
 .* . *********.********* *** *

87. spacer 3.1|4943357|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

gatggttgccggcgccggaggtacgcatgcag	CRISPR spacer
agtccctcccggcgccgcaggtacggatgcac	Protospacer
..*  .* ********* ******* *****

88. spacer 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MT074138 (Bacteroides phage DAC17, complete genome) position: , mismatch: 9, identity: 0.719 

gcagaaacaggaggagatgactttgttattaa	CRISPR spacer
tcagagacaggaggagataactttgacaaagc	Protospacer
 ****.************.****** .*  .

89. spacer 3.2|4943418|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MT074136 (Bacteroides phage DAC15, complete genome) position: , mismatch: 9, identity: 0.719 

gcagaaacaggaggagatgactttgttattaa	CRISPR spacer
tcagagacaggaggagataactttgacaaagc	Protospacer
 ****.************.****** .*  .

90. spacer 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719 

ggtactggtgcctggccgctctttccgcctgg	CRISPR spacer
ggtgctggtgcccggccgctctttgacgcaac	Protospacer
***.********.***********    * .

91. spacer 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to KP790010 (Gordonia phage GordDuk1, complete genome) position: , mismatch: 9, identity: 0.719 

ggtactggtgcctggccgctctttccgcctgg	CRISPR spacer
tcagctagtgcctgcccgctctttccggcctg	Protospacer
   .**.******* ************ *. *

92. spacer 3.5|4943601|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to KP790009 (Gordonia phage Gmala1, complete genome) position: , mismatch: 9, identity: 0.719 

ggtactggtgcctggccgctctttccgcctgg	CRISPR spacer
tcagctagtgcctgtccgctctttccggcctg	Protospacer
   .**.******* ************ *. *

93. spacer 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgcgccggacctggcgcaggaaatttgattac	CRISPR spacer
cgcgccggacgtggcgcaggagattgcggaag	Protospacer
.********* **********.***  .  *

94. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MH834599 (Microbacterium phage Bernstein, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

95. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

96. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

97. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MH834626 (Microbacterium phage Rollins, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

98. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

99. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttg	Protospacer
* ...  ******** **** **********.

100. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MK279874 (Arthrobacter phage Riovina, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
ccgcaggttccttgcggttcttgcggcgcttc	Protospacer
    *.*.*********** *.*********

101. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MK279851 (Arthrobacter phage Eunoia, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
ccgcaggttccttgcggttcttgcggcgcttc	Protospacer
    *.*.*********** *.*********

102. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MK112526 (Arthrobacter phage Aledel, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
ccgcaggttccttgcggttcttgcggcgcttc	Protospacer
    *.*.*********** *.*********

103. spacer 4.2|4949598|32|CP026193|CRISPRCasFinder,CRT matches to MK279868 (Arthrobacter phage OMalley, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaagctccttgcggttgtcgcggcgctta	CRISPR spacer
ccgcaggttccttgcggttcttgcggcgcttc	Protospacer
    *.*.*********** *.*********

104. spacer 4.6|4949842|32|CP026193|CRISPRCasFinder,CRT matches to MN850588 (Escherichia phage sortregn, complete genome) position: , mismatch: 9, identity: 0.719 

ttctgcgctcctttgctctcgactgcgatgcg	CRISPR spacer
tctaattctcctttgctctcgtctgcgctgtg	Protospacer
*.. .. ************** ***** **.*

105. spacer 4.11|4950147|32|CP026193|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719 

attctgacttcgcttttcatcagtaccggaac	CRISPR spacer
agcggtgcctcgcttttcatcaatatcggaac	Protospacer
* .   .*.*************.**.******

106. spacer 4.13|4949598|33|CP026193|PILER-CR matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
ctggtggctccttgcggtattcgcggcgcttgc	Protospacer
   * .************  ***********..

107. spacer 2.2|4933351|32|CP026193|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

attcagcaggtcagtgattgccatttcggatc	CRISPR spacer
attcagcaggccactgattgccagcagcatta	Protospacer
**********.** ********* .   . *

108. spacer 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ccgcagcaggaaacgtcacgccatcaagctcg	Protospacer
  .  . *.******* ************ **

109. spacer 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ccgcagcaggaaacgtcacgccatcaagctcg	Protospacer
  .  . *.******* ************ **

110. spacer 2.8|4933717|32|CP026193|CRT,CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ctggcggcagcagcgtgacgccatcaagcgca	Protospacer
  ..*.. ** *.******************.

111. spacer 2.16|4934205|32|CP026193|CRT,CRISPRCasFinder matches to MN840485 (Escherichia phage 2725-N35, complete genome) position: , mismatch: 10, identity: 0.688 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
gacgatgggggcggccagatgctgatgcacta	Protospacer
  .********** ****.*******.   *

112. spacer 2.21|4933720|32|CP026193|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ccgcagcaggaaacgtcacgccatcaagctcg	Protospacer
  .  . *.******* ************ **

113. spacer 2.21|4933720|32|CP026193|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ccgcagcaggaaacgtcacgccatcaagctcg	Protospacer
  .  . *.******* ************ **

114. spacer 2.21|4933720|32|CP026193|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

agaacaaaagaaacgtgacgccatcaagcgcg	CRISPR spacer
ctggcggcagcagcgtgacgccatcaagcgca	Protospacer
  ..*.. ** *.******************.

115. spacer 2.29|4934208|32|CP026193|PILER-CR matches to MN840485 (Escherichia phage 2725-N35, complete genome) position: , mismatch: 10, identity: 0.688 

tctgatgggggcgcccaggtgctgataatatc	CRISPR spacer
gacgatgggggcggccagatgctgatgcacta	Protospacer
  .********** ****.*******.   *

116. spacer 3.1|4943357|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.688 

gatggttgccggcgccggaggtacgcatgcag	CRISPR spacer
gatggttgccggcgccggggatatcaccacgc	Protospacer
******************.*.**.   ..*.

117. spacer 3.4|4943540|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU306397 (Corynebacterium glutamicum strain DSM 1412 plasmid pBL90, complete sequence) position: , mismatch: 10, identity: 0.688 

atgttgtcccaatggctgatcaggttatagaa	CRISPR spacer
cggttctcccaatggttgatcaggtctttagc	Protospacer
  *** *********.*********. * ..

118. spacer 3.7|4943723|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to MF417867 (Uncultured Caudovirales phage clone 3F_7, partial genome) position: , mismatch: 10, identity: 0.688 

caattgcagaataaacggatgataggaatgta	CRISPR spacer
ctcacccacaatcaacggatgataggaatagt	Protospacer
*   . ** *** ****************.

119. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046399 (Bacillus sp. A260 plasmid unnamed11, complete sequence) position: , mismatch: 10, identity: 0.688 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
attcaaatgatgaggcgggtaatgattctaac	Protospacer
..  .* ********** ******** ***

120. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031066 (Bacillus sp. SH8-8 plasmid pl193, complete sequence) position: , mismatch: 10, identity: 0.688 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
attcaaatgatgaggcgggtaatgattctaac	Protospacer
..  .* ********** ******** ***

121. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031063 (Bacillus sp. AR4-2 plasmid pl192, complete sequence) position: , mismatch: 10, identity: 0.688 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
attcaaatgatgaggcgggtaatgattctaac	Protospacer
..  .* ********** ******** ***

122. spacer 3.12|4944028|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018742 (Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence) position: , mismatch: 10, identity: 0.688 

gcaggattgatgaggcgcgtaatgatgctatg	CRISPR spacer
atttaaatgatgaggcgggtaatgattctaac	Protospacer
..  .* ********** ******** ***

123. spacer 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgacgccgataatgattggtctgtattgcgc	CRISPR spacer
aagacgccgattacgattggtctgttgatgac	Protospacer
  ********* *.***********     .*

124. spacer 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgacgccgataatgattggtctgtattgcgc	CRISPR spacer
aagacgccgattacgattggtctgttgatgac	Protospacer
  ********* *.***********     .*

125. spacer 3.13|4944089|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgacgccgataatgattggtctgtattgcgc	CRISPR spacer
aagacgccgattacgattggtctgttgatgac	Protospacer
  ********* *.***********     .*

126. spacer 4.3|4949659|32|CP026193|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcctctccttcacgatctattatttcacggag	CRISPR spacer
aataatgtttcacgatttattatgtcacggaa	Protospacer
  .  * .********.****** *******.

127. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MH834599 (Microbacterium phage Bernstein, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

128. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MH834602 (Microbacterium phage Brahms, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

129. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MN183281 (Microbacterium phage Vitas, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

130. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MH834626 (Microbacterium phage Rollins, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

131. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MH834604 (Microbacterium phage Coltrane, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

132. spacer 4.13|4949598|33|CP026193|PILER-CR matches to MH834596 (Microbacterium phage Armstrong, complete genome) position: , mismatch: 10, identity: 0.697 

aatgaagctccttgcggttgtcgcggcgcttat	CRISPR spacer
atcagctctccttgctgttggcgcggcgcttgc	Protospacer
* ...  ******** **** **********..

133. spacer 3.14|4944150|32|CP026193|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014353 (Acidipropionibacterium acidipropionici strain ATCC 55737 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

tgcgccggacctggcgcaggaaatttgattac	CRISPR spacer
ggcgctggacctggcgcaggagatgcacgagg	Protospacer
 ****.***************.** ..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1182579 : 1194024 11 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_2 1212210 : 1246041 50 Enterobacteria_phage(28.57%) lysis,capsid,terminase,portal,head,tail,transposase,holin,protease,integrase attL 1206231:1206245|attR 1221794:1221808
DBSCAN-SWA_3 1580448 : 1594767 16 Tupanvirus(11.11%) tRNA NA
DBSCAN-SWA_4 2352514 : 2398905 59 Enterobacteria_phage(51.11%) capsid,lysis,terminase,portal,head,tail,transposase,holin,integrase attL 2371412:2371428|attR 2402807:2402823
DBSCAN-SWA_5 3022452 : 3101656 85 Enterobacteria_phage(43.9%) capsid,tRNA,terminase,portal,tail,transposase,protease,plate,integrase attL 3063130:3063149|attR 3097504:3097523
DBSCAN-SWA_6 3303832 : 3327889 23 Salmonella_phage(37.5%) transposase,integrase attL 3301280:3301294|attR 3331850:3331864
DBSCAN-SWA_7 3933828 : 3996706 59 Pseudomonas_phage(16.67%) transposase NA
DBSCAN-SWA_8 4718636 : 4750840 18 Salmonella_phage(40.0%) transposase NA
DBSCAN-SWA_9 4969566 : 5013839 37 Vibrio_phage(12.5%) transposase,tRNA,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage