Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 0 crisprs csa3 0 0 4 0
CP026235 Citrobacter freundii complex sp. CFNIH3 chromosome, complete genome 1 crisprs DEDDh,WYL,RT,DinG,cas3,csa3,cas4,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 31 12 0
CP026236 Citrobacter freundii complex sp. CFNIH3 plasmid pKPC-59e4, complete sequence 0 crisprs csa3 0 0 7 0

Results visualization

1. CP026237
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1211 : 36767 37 Salmonella_phage(42.86%) transposase NA
DBSCAN-SWA_2 54660 : 128700 60 Escherichia_phage(41.67%) transposase,protease NA
DBSCAN-SWA_3 132854 : 200999 54 Escherichia_phage(36.67%) transposase,plate,integrase attL 135669:135728|attR 202369:203761
DBSCAN-SWA_4 212835 : 224015 11 Escherichia_phage(57.14%) transposase,integrase attL 205724:205738|attR 222258:222272

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026235
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026235_1 3985668-3988018 TypeI-E I-E
38 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 40456-40487 0 1.0
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NC_004775 Enterobacteria phage epsilon15, complete genome 34329-34360 0 1.0
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 2747-2778 0 1.0
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 KY914478 Escherichia phage ArgO145, complete genome 5665-5696 1 0.969
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 9162-9193 1 0.969
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 NZ_KP792123 Escherichia coli strain MG1655 YFP plasmid ESBL242, complete sequence 101128-101159 2 0.938
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 2930-2961 2 0.938
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 KY271395 Klebsiella phage 2b LV-2017, complete genome 3070-3101 2 0.938
CP026235_1 1.26|3987226|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987226-3987257 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 144791-144822 5 0.844
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 77528-77559 6 0.812
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 27654-27685 6 0.812
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 90496-90527 6 0.812
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NC_047875 Salmonella phage UPF_BP1, complete genome 35708-35739 6 0.812
CP026235_1 1.9|3986187|32|CP026235|CRISPRCasFinder,CRT 3986187-3986218 32 KU052037 Escherichia phage Rac-SA53, complete genome 3312-3343 6 0.812
CP026235_1 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT 3986798-3986829 32 MH572281 Microviridae sp. isolate SD_SC_105, complete genome 907-938 6 0.812
CP026235_1 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987042-3987073 32 KY271395 Klebsiella phage 2b LV-2017, complete genome 6901-6932 6 0.812
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 77528-77559 6 0.812
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 27654-27685 6 0.812
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 90496-90527 6 0.812
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NC_047875 Salmonella phage UPF_BP1, complete genome 35708-35739 6 0.812
CP026235_1 1.47|3986188|32|CP026235|PILER-CR 3986188-3986219 32 KU052037 Escherichia phage Rac-SA53, complete genome 3312-3343 6 0.812
CP026235_1 1.57|3986799|32|CP026235|PILER-CR 3986799-3986830 32 MH572281 Microviridae sp. isolate SD_SC_105, complete genome 907-938 6 0.812
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 555888-555919 7 0.781
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1275735-1275766 7 0.781
CP026235_1 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987348-3987379 32 MG751100 Klebsiella phage KP1, complete genome 93932-93963 7 0.781
CP026235_1 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987348-3987379 32 MK421971 Klebsiella phage vB_KpnM_GF, partial genome 89735-89766 7 0.781
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 112122-112153 7 0.781
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 32529-32560 7 0.781
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 35696-35727 7 0.781
CP026235_1 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987470-3987501 32 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 71318-71349 7 0.781
CP026235_1 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987531-3987562 32 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 409304-409335 7 0.781
CP026235_1 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987531-3987562 32 NZ_CP028350 Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence 373419-373450 7 0.781
CP026235_1 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987531-3987562 32 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 198515-198546 7 0.781
CP026235_1 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987531-3987562 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 340453-340484 7 0.781
CP026235_1 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987775-3987806 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1330822-1330853 7 0.781
CP026235_1 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987775-3987806 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1307509-1307540 7 0.781
CP026235_1 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987775-3987806 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 176687-176718 7 0.781
CP026235_1 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987775-3987806 32 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 186183-186214 7 0.781
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 555888-555919 7 0.781
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1275735-1275766 7 0.781
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 44506-44537 8 0.75
CP026235_1 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT 3985758-3985789 32 MT310870 Mycobacterium phage RawrgerThat, complete genome 58633-58664 8 0.75
CP026235_1 1.8|3986126|32|CP026235|CRISPRCasFinder,CRT 3986126-3986157 32 NC_020907 Octadecabacter antarcticus 307 plasmid pOA307_63, complete sequence 22014-22045 8 0.75
CP026235_1 1.12|3986371|32|CP026235|CRISPRCasFinder,CRT 3986371-3986402 32 MN693509 Marine virus AFVG_25M367, complete genome 53778-53809 8 0.75
CP026235_1 1.14|3986493|32|CP026235|CRISPRCasFinder,CRT 3986493-3986524 32 MN310371 Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence 41097-41128 8 0.75
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_022056 Mycobacterium phage Hamulus, complete genome 40872-40903 8 0.75
CP026235_1 1.20|3986859|32|CP026235|CRISPRCasFinder,CRT 3986859-3986890 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 623199-623230 8 0.75
CP026235_1 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987042-3987073 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 38770-38801 8 0.75
CP026235_1 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987042-3987073 32 KY271396 Klebsiella phage 2 LV-2017, complete genome 36325-36356 8 0.75
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1469790-1469821 8 0.75
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1202057-1202088 8 0.75
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 983533-983564 8 0.75
CP026235_1 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987592-3987623 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 11220-11251 8 0.75
CP026235_1 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT 3987653-3987684 32 NZ_CP040393 Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence 3391-3422 8 0.75
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 44506-44537 8 0.75
CP026235_1 1.40|3985759|32|CP026235|PILER-CR 3985759-3985790 32 MT310870 Mycobacterium phage RawrgerThat, complete genome 58633-58664 8 0.75
CP026235_1 1.46|3986127|32|CP026235|PILER-CR 3986127-3986158 32 NC_020907 Octadecabacter antarcticus 307 plasmid pOA307_63, complete sequence 22014-22045 8 0.75
CP026235_1 1.50|3986372|32|CP026235|PILER-CR 3986372-3986403 32 MN693509 Marine virus AFVG_25M367, complete genome 53778-53809 8 0.75
CP026235_1 1.52|3986494|32|CP026235|PILER-CR 3986494-3986525 32 MN310371 Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence 41097-41128 8 0.75
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_022056 Mycobacterium phage Hamulus, complete genome 40872-40903 8 0.75
CP026235_1 1.7|3986065|32|CP026235|CRISPRCasFinder,CRT 3986065-3986096 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 238627-238658 9 0.719
CP026235_1 1.15|3986554|32|CP026235|CRISPRCasFinder,CRT 3986554-3986585 32 NZ_CP021826 Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence 93749-93780 9 0.719
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 364788-364819 9 0.719
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 903678-903709 9 0.719
CP026235_1 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT 3986798-3986829 32 NC_021299 Mycobacterium phage PegLeg, complete genome 64350-64381 9 0.719
CP026235_1 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT 3986798-3986829 32 MK937612 Mycobacterium phage LilhomieP, complete genome 64466-64497 9 0.719
CP026235_1 1.20|3986859|32|CP026235|CRISPRCasFinder,CRT 3986859-3986890 32 MF360958 Salicola phage SCTP-2, complete genome 87439-87470 9 0.719
CP026235_1 1.26|3987226|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987226-3987257 32 MN094788 Achromobacter phage Motura, complete genome 52788-52819 9 0.719
CP026235_1 1.36|3987836|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987836-3987867 32 NZ_CP010871 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence 28328-28359 9 0.719
CP026235_1 1.45|3986066|32|CP026235|PILER-CR 3986066-3986097 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 238627-238658 9 0.719
CP026235_1 1.53|3986555|32|CP026235|PILER-CR 3986555-3986586 32 NZ_CP021826 Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence 93749-93780 9 0.719
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 364788-364819 9 0.719
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 903678-903709 9 0.719
CP026235_1 1.57|3986799|32|CP026235|PILER-CR 3986799-3986830 32 NC_021299 Mycobacterium phage PegLeg, complete genome 64350-64381 9 0.719
CP026235_1 1.57|3986799|32|CP026235|PILER-CR 3986799-3986830 32 MK937612 Mycobacterium phage LilhomieP, complete genome 64466-64497 9 0.719
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 398811-398842 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1031451-1031482 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1053882-1053913 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 554582-554613 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1051232-1051263 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1610131-1610162 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 573765-573796 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1093173-1093204 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 495806-495837 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 10599-10630 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 451737-451768 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1233751-1233782 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 986009-986040 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 953425-953456 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1331757-1331788 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 139499-139530 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1319487-1319518 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 887791-887822 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 850541-850572 10 0.688
CP026235_1 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT 3985819-3985850 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1029790-1029821 10 0.688
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 749952-749983 10 0.688
CP026235_1 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT 3986798-3986829 32 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 52244-52275 10 0.688
CP026235_1 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987348-3987379 32 MN855853 Siphoviridae sp. isolate 257, partial genome 8618-8649 10 0.688
CP026235_1 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT 3987653-3987684 32 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1058218-1058249 10 0.688
CP026235_1 1.34|3987714|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987714-3987745 32 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 388370-388401 10 0.688
CP026235_1 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR 3987775-3987806 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 193558-193589 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 398811-398842 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1031451-1031482 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 1053882-1053913 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 554582-554613 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1051232-1051263 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1610131-1610162 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 573765-573796 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1093173-1093204 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 495806-495837 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 10599-10630 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 451737-451768 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1233751-1233782 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 986009-986040 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 953425-953456 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1331757-1331788 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 139499-139530 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1319487-1319518 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 887791-887822 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 850541-850572 10 0.688
CP026235_1 1.41|3985820|32|CP026235|PILER-CR 3985820-3985851 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1029790-1029821 10 0.688
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 749952-749983 10 0.688
CP026235_1 1.57|3986799|32|CP026235|PILER-CR 3986799-3986830 32 NZ_CP031070 Bacillus sp. JAS24-2 plasmid pl278, complete sequence 52244-52275 10 0.688
CP026235_1 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT 3987653-3987684 32 NZ_CP023734 Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence 38822-38853 11 0.656
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 759679-759710 18 0.438
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 609050-609081 18 0.438
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 347990-348021 18 0.438
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 759679-759710 18 0.438
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 609050-609081 18 0.438
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 347990-348021 18 0.438
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 821919-821950 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1258876-1258907 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1235848-1235879 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 774583-774614 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 654601-654632 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1030113-1030144 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1269825-1269856 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1157064-1157095 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1111281-1111312 19 0.406
CP026235_1 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT 3986737-3986768 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 821586-821617 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 821919-821950 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1258876-1258907 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1235848-1235879 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 774583-774614 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 654601-654632 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1030113-1030144 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1269825-1269856 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1157064-1157095 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1111281-1111312 19 0.406
CP026235_1 1.56|3986738|32|CP026235|PILER-CR 3986738-3986769 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 821586-821617 19 0.406

1. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccacctcatcagcgagcgcagacctcag	Protospacer
********************************

2. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 0, identity: 1.0 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccacctcatcagcgagcgcagacctcag	Protospacer
********************************

3. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccacctcatcagcgagcgcagacctcag	Protospacer
********************************

4. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to KY914478 (Escherichia phage ArgO145, complete genome) position: , mismatch: 1, identity: 0.969 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tgaagcatatttccatcaaaacgaatgaccgg	Protospacer
***************************** **

5. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.969 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccatctcatcagcgagcgcagacctcag	Protospacer
*******.************************

6. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP792123 (Escherichia coli strain MG1655 YFP plasmid ESBL242, complete sequence) position: , mismatch: 2, identity: 0.938 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tgaagcatatttccagcaaaacgaatgaccgg	Protospacer
*************** ************* **

7. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.938 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccatctcatcagcgagtgcagacctcag	Protospacer
*******.************.***********

8. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 2, identity: 0.938 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
tcttccatctcatcagcgagctcagacctcag	Protospacer
*******.************* **********

9. spacer 1.26|3987226|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.844 

ctcagcagatgctagagaagctggg-gttacgc	CRISPR spacer
cgcagcagatgctggacaagctgggcgttgcg-	Protospacer
* ***********.** ******** ***.**

10. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

11. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

12. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

13. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
ttgacatcccgcgcctccagttctgctatgcg	Protospacer
** **  .************.** ********

14. spacer 1.9|3986187|32|CP026235|CRISPRCasFinder,CRT matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 6, identity: 0.812 

tacggccaaataggcgagctgttgtttaggat	CRISPR spacer
caacgccagataggcgagctgttgtttcgggt	Protospacer
.*  ****.****************** **.*

15. spacer 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT matches to MH572281 (Microviridae sp. isolate SD_SC_105, complete genome) position: , mismatch: 6, identity: 0.812 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
ttaggcggttctcgttatgttgaaattattcg	Protospacer
* . * *************** *****.****

16. spacer 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 6, identity: 0.812 

ttttatcttaaatatgtactattggtacttta	CRISPR spacer
ttccaaattaaaaatgtacttttggtacttta	Protospacer
**..*  ***** ******* ***********

17. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

18. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

19. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgtccgcgcctccagctcgacgccgcg	Protospacer
 **.********************.*  .***

20. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 6, identity: 0.812 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
ttgacatcccgcgcctccagttctgctatgcg	Protospacer
** **  .************.** ********

21. spacer 1.47|3986188|32|CP026235|PILER-CR matches to KU052037 (Escherichia phage Rac-SA53, complete genome) position: , mismatch: 6, identity: 0.812 

tacggccaaataggcgagctgttgtttaggat	CRISPR spacer
caacgccagataggcgagctgttgtttcgggt	Protospacer
.*  ****.****************** **.*

22. spacer 1.57|3986799|32|CP026235|PILER-CR matches to MH572281 (Microviridae sp. isolate SD_SC_105, complete genome) position: , mismatch: 6, identity: 0.812 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
ttaggcggttctcgttatgttgaaattattcg	Protospacer
* . * *************** *****.****

23. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgcccgcgcctccagctcgacgccgcg	Protospacer
 **.***.****************.*  .***

24. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
gagtcccgcgatggccgcagccgccgcgctga	Protospacer
* **  **.***************.****.*

25. spacer 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MG751100 (Klebsiella phage KP1, complete genome) position: , mismatch: 7, identity: 0.781 

ctttgtaactactttgccagcttccagatgca	CRISPR spacer
gatttcaactacttcgccagcttccagacgct	Protospacer
  ** .********.*************.**

26. spacer 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MK421971 (Klebsiella phage vB_KpnM_GF, partial genome) position: , mismatch: 7, identity: 0.781 

ctttgtaactactttgccagcttccagatgca	CRISPR spacer
gatttcaactacttcgccagcttccagacgct	Protospacer
  ** .********.*************.**

27. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tggtccggatttccatcaaaaagcatgacagg	Protospacer
**.  *. ************* * ********

28. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tggtccggatttccatcaaaaagcatgacagg	Protospacer
**.  *. ************* * ********

29. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tggtccggatttccatcaaaaagcatgacagg	Protospacer
**.  *. ************* * ********

30. spacer 1.30|3987470|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 7, identity: 0.781 

tgaagcatatttccatcaaaacgaatgacagg	CRISPR spacer
tggtccggatttccatcaaaaagcatgacagg	Protospacer
**.  *. ************* * ********

31. spacer 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

-caaaccaagacgctcaccgagtttctgaatat	CRISPR spacer
acgcacc-aggcggtcaccgagtttctgaatca	Protospacer
 *. *** **.** *****************

32. spacer 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 7, identity: 0.781 

-caaaccaagacgctcaccgagtttctgaatat	CRISPR spacer
acgcacc-aggcggtcaccgagtttctgaatca	Protospacer
 *. *** **.** *****************

33. spacer 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 7, identity: 0.781 

-caaaccaagacgctcaccgagtttctgaatat	CRISPR spacer
acgcacc-aggcggtcaccgagtttctgaatca	Protospacer
 *. *** **.** *****************

34. spacer 1.31|3987531|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

-caaaccaagacgctcaccgagtttctgaatat	CRISPR spacer
acgcacc-aggcggtcaccgagtttctgaatca	Protospacer
 *. *** **.** *****************

35. spacer 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcgcctcaatgacggcgatggagagagcaga	CRISPR spacer
gtcgcctcaacgtcggcgatggagcacgacga	Protospacer
**********.* *********** . *  **

36. spacer 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcgcctcaatgacggcgatggagagagcaga	CRISPR spacer
gtcgcctcaacgtcggcgatggagcacgacga	Protospacer
**********.* *********** . *  **

37. spacer 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcgcc--tcaatgacggcgatggagagagcaga	CRISPR spacer
--cggcgaacgatgacggcgatggagagcgccga	Protospacer
  ** *   *.***************** ** **

38. spacer 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 7, identity: 0.781 

gtcgcc--tcaatgacggcgatggagagagcaga	CRISPR spacer
--cggcgaacgatgacggcgatggagagcgccga	Protospacer
  ** *   *.***************** ** **

39. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
atcgccgcccgcgcctccagctcgacgccgcg	Protospacer
 **.***.****************.*  .***

40. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
gagtcccgcgatggccgcagccgccgcgctga	Protospacer
* **  **.***************.****.*

41. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
tttatttctcgcgcctccagttctgctatgcg	Protospacer
**.*.. ..***********.** ********

42. spacer 1.2|3985758|32|CP026235|CRISPRCasFinder,CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 8, identity: 0.75 

ttcaccgtccgcgcctccagctc-ggctatgcg	CRISPR spacer
gccaccgccagcgcctccagctcgggccactc-	Protospacer
 .*****.* ************* ***.*. *

43. spacer 1.8|3986126|32|CP026235|CRISPRCasFinder,CRT matches to NC_020907 (Octadecabacter antarcticus 307 plasmid pOA307_63, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtggcaaactgcgtgagtgctgcggcgatat	CRISPR spacer
ggtggcaaactgcgtgaatggtgagaccccag	Protospacer
*****************.** ** *.*  .*

44. spacer 1.12|3986371|32|CP026235|CRISPRCasFinder,CRT matches to MN693509 (Marine virus AFVG_25M367, complete genome) position: , mismatch: 8, identity: 0.75 

ttgatagtaatttcgtaaatcctgccgtatgc	CRISPR spacer
ttgagagtaattttgtaaatcctttactttga	Protospacer
**** ********.********* .  * **

45. spacer 1.14|3986493|32|CP026235|CRISPRCasFinder,CRT matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 8, identity: 0.75 

catcatcgcaatcgatatcgagtcctcaatat	CRISPR spacer
gctctgggtaatcgatatcgcgtcgtcaatat	Protospacer
  **   *.*********** *** *******

46. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 8, identity: 0.75 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
tactcgcgtgagggccgcagccgatgcgcggg	Protospacer
   * ****** *********** ***** *

47. spacer 1.20|3986859|32|CP026235|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75 

cgagatcataaagacgccactgatctggctgt--	CRISPR spacer
gcaggtcatagagacgccactgatcc--ttgtcg	Protospacer
  **.*****.**************.  .***

48. spacer 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 8, identity: 0.75 

ttttatcttaaatatgtactattggtacttta	CRISPR spacer
tgccaaatcaaaaatgtacttttggtacttta	Protospacer
* ..*  *.*** ******* ***********

49. spacer 1.23|3987042|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 8, identity: 0.75 

ttttatcttaaatatgtactattggtacttta	CRISPR spacer
taccaaatcaaaaatgtacttttggtacttta	Protospacer
* ..*  *.*** ******* ***********

50. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
ggtaccacctcatcagcgagtgccgacctgca	Protospacer
  * ****************.** *****  .

51. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
ggtaccacctcatcagcgagtgccgacctgca	Protospacer
  * ****************.** *****  .

52. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
ggtaccacctcatcagcgagtgccgacctgca	Protospacer
  * ****************.** *****  .

53. spacer 1.32|3987592|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcttccacctcatcagcgagcgcagacctcag	CRISPR spacer
ggtaccacctcatcagcgagtgccgacctgca	Protospacer
  * ****************.** *****  .

54. spacer 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP040393 (Kosakonia radicincitans strain DSM 107547 plasmid pKrDSM107547, complete sequence) position: , mismatch: 8, identity: 0.75 

acggcatcgcgcaatttttccagattggccag	CRISPR spacer
atggcatcgcgcattttttccagataaggggt	Protospacer
*.*********** *********** .*  .

55. spacer 1.40|3985759|32|CP026235|PILER-CR matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcaccgtccgcgcctccagctcggctatgcg	CRISPR spacer
tttatttctcgcgcctccagttctgctatgcg	Protospacer
**.*.. ..***********.** ********

56. spacer 1.40|3985759|32|CP026235|PILER-CR matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 8, identity: 0.75 

ttcaccgtccgcgcctccagctc-ggctatgcg	CRISPR spacer
gccaccgccagcgcctccagctcgggccactc-	Protospacer
 .*****.* ************* ***.*. *

57. spacer 1.46|3986127|32|CP026235|PILER-CR matches to NC_020907 (Octadecabacter antarcticus 307 plasmid pOA307_63, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtggcaaactgcgtgagtgctgcggcgatat	CRISPR spacer
ggtggcaaactgcgtgaatggtgagaccccag	Protospacer
*****************.** ** *.*  .*

58. spacer 1.50|3986372|32|CP026235|PILER-CR matches to MN693509 (Marine virus AFVG_25M367, complete genome) position: , mismatch: 8, identity: 0.75 

ttgatagtaatttcgtaaatcctgccgtatgc	CRISPR spacer
ttgagagtaattttgtaaatcctttactttga	Protospacer
**** ********.********* .  * **

59. spacer 1.52|3986494|32|CP026235|PILER-CR matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 8, identity: 0.75 

catcatcgcaatcgatatcgagtcctcaatat	CRISPR spacer
gctctgggtaatcgatatcgcgtcgtcaatat	Protospacer
  **   *.*********** *** *******

60. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 8, identity: 0.75 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
tactcgcgtgagggccgcagccgatgcgcggg	Protospacer
   * ****** *********** ***** *

61. spacer 1.7|3986065|32|CP026235|CRISPRCasFinder,CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719 

gccgggaccgcgaacgctgctgactatccctg	CRISPR spacer
gccgggagcgcgaacgccgctgacggccaggc	Protospacer
******* *********.****** ..*

62. spacer 1.15|3986554|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021826 (Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtcaacgtccggctcaattgccccctcgtt	CRISPR spacer
gcgtcaacgtccggctcgattaccctcggaga	Protospacer
 ****************.***.***.*  .

63. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
cctactcgggatggccgcagccgctgcgctat	Protospacer
 *    ** ********************...

64. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
cgacggcgtgatggccggagcggctgcggcag	Protospacer
  ..************* *** ****** *.

65. spacer 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT matches to NC_021299 (Mycobacterium phage PegLeg, complete genome) position: , mismatch: 9, identity: 0.719 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
tggcggggttctcgttgtgctcattgagccag	Protospacer
****************.**.***    *.. *

66. spacer 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT matches to MK937612 (Mycobacterium phage LilhomieP, complete genome) position: , mismatch: 9, identity: 0.719 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
tggcggggttctcgttgtgctcattgagccag	Protospacer
****************.**.***    *.. *

67. spacer 1.20|3986859|32|CP026235|CRISPRCasFinder,CRT matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 9, identity: 0.719 

cgagatcataaagacgccactgatctggctgt	CRISPR spacer
caagatcatatagacgcaactgatccacatac	Protospacer
*.******** ****** *******..  *..

68. spacer 1.26|3987226|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MN094788 (Achromobacter phage Motura, complete genome) position: , mismatch: 9, identity: 0.719 

ctcagcagatgctagagaagctggggttacgc	CRISPR spacer
ctcagcagatgctagaccagctgcgagcgatc	Protospacer
****************  ***** *. ..  *

69. spacer 1.36|3987836|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 9, identity: 0.719 

aagagccagttccctgaaacgcaaattgcccg	CRISPR spacer
agcagccagttccctgatacgcacatcgtagc	Protospacer
*. ************** ***** **.*.

70. spacer 1.45|3986066|32|CP026235|PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719 

gccgggaccgcgaacgctgctgactatccctg	CRISPR spacer
gccgggagcgcgaacgccgctgacggccaggc	Protospacer
******* *********.****** ..*

71. spacer 1.53|3986555|32|CP026235|PILER-CR matches to NZ_CP021826 (Sinorhizobium meliloti strain KH35c plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgtcaacgtccggctcaattgccccctcgtt	CRISPR spacer
gcgtcaacgtccggctcgattaccctcggaga	Protospacer
 ****************.***.***.*  .

72. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
cctactcgggatggccgcagccgctgcgctat	Protospacer
 *    ** ********************...

73. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
cgacggcgtgatggccggagcggctgcggcag	Protospacer
  ..************* *** ****** *.

74. spacer 1.57|3986799|32|CP026235|PILER-CR matches to NC_021299 (Mycobacterium phage PegLeg, complete genome) position: , mismatch: 9, identity: 0.719 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
tggcggggttctcgttgtgctcattgagccag	Protospacer
****************.**.***    *.. *

75. spacer 1.57|3986799|32|CP026235|PILER-CR matches to MK937612 (Mycobacterium phage LilhomieP, complete genome) position: , mismatch: 9, identity: 0.719 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
tggcggggttctcgttgtgctcattgagccag	Protospacer
****************.**.***    *.. *

76. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

77. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

78. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

79. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

80. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

81. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

82. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

83. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

84. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

85. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

86. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

87. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

88. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

89. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

90. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

91. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

92. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

93. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

94. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

95. spacer 1.3|3985819|32|CP026235|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

96. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
atttcctcagatggcagcagccgcagcgccgc	Protospacer
.. *  .  ****** ******** *******

97. spacer 1.19|3986798|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 10, identity: 0.688 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
ttttatagttcgctttatgttcaaattgttat	Protospacer
*  .. .**** * ****************

98. spacer 1.28|3987348|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to MN855853 (Siphoviridae sp. isolate 257, partial genome) position: , mismatch: 10, identity: 0.688 

ctttgtaactactttgccagcttccagatgca	CRISPR spacer
aggagtaactactaagccagcttccagcagag	Protospacer
    *********  ************  * .

99. spacer 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 10, identity: 0.688 

acggcatcgcgcaatttttccagattggccag	CRISPR spacer
acggcctggcgcaatttttccaggagaacgga	Protospacer
***** * ***************.  ..* ..

100. spacer 1.34|3987714|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 10, identity: 0.688 

acgaaccgcacccgacagcggcctccctctgt	CRISPR spacer
ctaaaccgcacccggcagcgacctcctgacgg	Protospacer
 ..***********.*****.*****.  .*

101. spacer 1.35|3987775|32|CP026235|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 10, identity: 0.688 

gtcgcctcaatgacggcgatggagagagcaga	CRISPR spacer
cggagaacgatgacggcgatggagagcgccga	Protospacer
   .   *.***************** ** **

102. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

103. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

104. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

105. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

106. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

107. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

108. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

109. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

110. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

111. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

112. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

113. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

114. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

115. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

116. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

117. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

118. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

119. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

120. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

121. spacer 1.41|3985820|32|CP026235|PILER-CR matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcaaaacgccctgctaaatggggccgcgcac	CRISPR spacer
atgaccgcgccctgctcaatggtgccgcgctg	Protospacer
   *  .********* ***** *******

122. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgtggcgtgatggccgcagccgctgcgccgc	CRISPR spacer
atttcctcagatggcagcagccgcagcgccgc	Protospacer
.. *  .  ****** ******** *******

123. spacer 1.57|3986799|32|CP026235|PILER-CR matches to NZ_CP031070 (Bacillus sp. JAS24-2 plasmid pl278, complete sequence) position: , mismatch: 10, identity: 0.688 

tggcggggttctcgttatgttcaaattgttcg	CRISPR spacer
ttttatagttcgctttatgttcaaattgttat	Protospacer
*  .. .**** * ****************

124. spacer 1.33|3987653|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP023734 (Escherichia coli strain FORC 064 plasmid pFORC64.3, complete sequence) position: , mismatch: 11, identity: 0.656 

acggcatcgcgcaatttttccagattggccag	CRISPR spacer
catgcatcgcgcattttgtccagattaaagca	Protospacer
   ********** *** ********..   .

125. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

126. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

127. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

128. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

129. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

130. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 18, identity: 0.438 

gcgtggcgtgatggccgcagccgctgcgccgc-----------	CRISPR spacer
-----------cgcaggcagccgctgcggccataacgcccggc	Protospacer
           .*   ************ *

131. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

132. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

133. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

134. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

135. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

136. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

137. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

138. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

139. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

140. spacer 1.18|3986737|32|CP026235|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

141. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

142. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

143. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

144. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

145. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

146. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

147. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

148. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

149. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

150. spacer 1.56|3986738|32|CP026235|PILER-CR matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 19, identity: 0.406 

gcgtggcgtgatggccgcagccgctgcgccgc-----	CRISPR spacer
-----cacaggcagccgctgcggccataacgcccggc	Protospacer
         *...***** ** **.... ***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 982540 : 1018036 42 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_2 1953396 : 1959157 9 uncultured_Caudovirales_phage(66.67%) transposase NA
DBSCAN-SWA_3 2087430 : 2146720 52 Vibrio_phage(18.18%) coat,integrase,transposase attL 2085835:2085851|attR 2138817:2138833
DBSCAN-SWA_4 2778494 : 2844888 85 Escherichia_phage(43.1%) holin,integrase,tail,coat,terminase,protease attL 2791388:2791415|attR 2842644:2842671
DBSCAN-SWA_5 3100176 : 3106477 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_6 3148362 : 3157929 8 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_7 3196026 : 3204469 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 3413464 : 3485972 90 Enterobacteria_phage(20.37%) holin,portal,head,capsid,tRNA,integrase,tail,transposase,terminase,protease attL 3438101:3438123|attR 3479088:3479110
DBSCAN-SWA_9 4190156 : 4305399 104 Escherichia_phage(32.14%) plate,tRNA,integrase,transposase,protease attL 4240561:4240620|attR 4256064:4256720
DBSCAN-SWA_10 4565173 : 4572824 10 Pseudoalteromonas_phage(16.67%) NA NA
DBSCAN-SWA_11 4594825 : 4648497 60 uncultured_Caudovirales_phage(60.0%) portal,capsid,tRNA,integrase,tail,protease,terminase,head attL 4636119:4636134|attR 4661578:4661593
DBSCAN-SWA_12 4709239 : 4800419 96 Enterobacteria_phage(41.38%) holin,portal,capsid,tRNA,integrase,tail,transposase,terminase,head attL 4707437:4707454|attR 4785998:4786015

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP026236
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1448 2 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_2 5231 : 6092 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_3 9321 : 9879 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_4 15954 : 28991 11 Escherichia_phage(25.0%) transposase NA
DBSCAN-SWA_5 32354 : 40851 8 uncultured_Caudovirales_phage(60.0%) transposase NA
DBSCAN-SWA_6 49515 : 54394 3 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_7 58135 : 61676 4 uncultured_Caudovirales_phage(66.67%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage