Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 0 crisprs NA 0 0 1 0
CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 0 crisprs NA 0 0 2 0
CP025509 Rhizobium leguminosarum bv. viciae strain UPM791 chromosome, complete genome 2 crisprs cas3,csa3,WYL,RT,DEDDh 0 2 4 0
CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 0 crisprs RT,csa3 0 0 0 0
CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 0 crisprs csa3,DEDDh 0 0 1 0
CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 0 crisprs DinG,RT 0 0 1 0

Results visualization

1. CP025509
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025509_1 149446-149519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025509_2 639513-639592 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025509_1 1.1|149469|28|CP025509|CRISPRCasFinder 149469-149496 28 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 168375-168402 5 0.821
CP025509_2 2.1|639536|34|CP025509|CRISPRCasFinder 639536-639569 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 179879-179912 9 0.735

1. spacer 1.1|149469|28|CP025509|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.821

gtccgggattgcgtacttcaaatcaatc	CRISPR spacer
gtccgggattccgcacttcaaatcacgg	Protospacer
********** **.***********   

2. spacer 2.1|639536|34|CP025509|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.735

cgggcaacatcatgctcccactattaaagcatgg	CRISPR spacer
cggacaacatcatgctccaactatataatttaga	Protospacer
***.************** *****  ** .  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1687166 : 1700605 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_2 1930666 : 1940932 10 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_3 2923460 : 2937263 11 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_4 3791623 : 3801556 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025505
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 136370 : 164058 25 Stx2-converting_phage(25.0%) transposase,integrase attL 156720:156758|attR 164059:164097
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP025510
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11514 : 113407 104 Streptococcus_phage(32.14%) integrase,transposase attL 57631:57649|attR 110971:110989
DBSCAN-SWA_2 121497 : 186488 59 Mycobacterium_phage(29.17%) integrase,transposase attL 157021:157054|attR 179883:179916
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP025508
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 344014 : 405186 53 Escherichia_phage(20.0%) holin,transposase,integrase attL 376336:376354|attR 410396:410414
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP025506
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 84649 : 93758 9 Planktothrix_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage