Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP026814 Shigella boydii strain 83-578 chromosome, complete genome 3 crisprs NA 0 2 0 0

Results visualization

1. CP026814
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026814_1 2462772-2462913 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026814_2 2549333-2549448 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026814_3 2615331-2615462 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026814_2 2.1|2549364|54|CP026814|CRISPRCasFinder 2549364-2549417 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4158-4217 8 0.867
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4157-4216 8 0.867
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115798-115857 8 0.867
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4157-4216 8 0.867
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4157-4216 8 0.867
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7435-7494 11 0.817
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84259-84318 11 0.817
CP026814_2 2.1|2549364|54|CP026814|CRISPRCasFinder 2549364-2549417 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP026814_1 1.1|2462813|60|CP026814|CRISPRCasFinder 2462813-2462872 60 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40377-40436 14 0.767

1. spacer 2.1|2549364|54|CP026814|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.867 

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

3. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.867 

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

4. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.867 

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

5. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.867 

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

6. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.867 

ggtttgtgcc-gaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgca	CRISPR spacer
-acttgtgcctgaacggtaggacggataaggcgttcacgccgcatccggcagtt-gtgca	Protospacer
 ..******* **** ***** ******************************** *.***

7. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.817 

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

8. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.817 

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttggcgcac	CRISPR spacer
aaactgcactcaaccgtaggccggataaggcgttcacgccgcatccggcaatt-gtgcac	Protospacer
.. .**..*. ***************************************.** *.****

9. spacer 2.1|2549364|54|CP026814|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****

10. spacer 1.1|2462813|60|CP026814|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.767 

ggtttgtgccgaaccgtaggccggataaggcgttcacgccgcatccggcagttgg-cgca	CRISPR spacer
cactcgcaccaaaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgta	Protospacer
 ..*.*..**.***********************.***************.  .* **.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage