Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026824 Shigella dysenteriae strain CFSAN010954 chromosome, complete genome 6 crisprs NA 0 4 0 0

Results visualization

1. CP026824
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_1 485134-485225 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_2 782372-782516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_3 1494904-1495019 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_4 1518486-1518618 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_5 3251986-3252136 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026824_6 3995023-3995140 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026824_1 1.1|485160|40|CP026824|CRISPRCasFinder 485160-485199 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP026824_3 3.1|1494935|54|CP026824|CRISPRCasFinder 1494935-1494988 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP026824_4 4.1|1518503|42|CP026824|PILER-CR 1518503-1518544 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
CP026824_4 4.2|1518562|40|CP026824|PILER-CR 1518562-1518601 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP026824_3 3.1|1494935|54|CP026824|CRISPRCasFinder 1494935-1494988 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778

1. spacer 1.1|485160|40|CP026824|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 3.1|1494935|54|CP026824|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
*****************************************************

3. spacer 4.1|1518503|42|CP026824|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976 

tgtcacacgcagataaatccaactttcaatattgttaagtcc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
****************************************.*

4. spacer 4.2|1518562|40|CP026824|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95 

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

5. spacer 3.1|1494935|54|CP026824|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage