CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
CP026828_1 |
1.1|1635455|54|CP026828|CRISPRCasFinder |
1635455-1635508 |
54 |
NZ_AP023206 |
Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence |
165411-165464 |
1 |
0.981 |
CP026828_2 |
2.1|3178218|38|CP026828|CRISPRCasFinder |
3178218-3178255 |
38 |
NZ_CP043437 |
Enterobacter sp. LU1 plasmid unnamed |
113727-113764 |
2 |
0.947 |
CP026828_1 |
1.1|1635455|54|CP026828|CRISPRCasFinder |
1635455-1635508 |
54 |
NZ_CP048385 |
Citrobacter freundii strain 62 plasmid p6_C, complete sequence |
72431-72484 |
12 |
0.778 |
1. spacer 1.1|1635455|54|CP026828|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981
gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca Protospacer
*****************************************************
2. spacer 2.1|3178218|38|CP026828|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
3. spacer 1.1|1635455|54|CP026828|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778
gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta----- Protospacer
* ******************************** *.*** *.. ****