Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026831 Shigella dysenteriae strain ATCC 12039 chromosome, complete genome 3 crisprs NA 0 5 0 0
CP026830 Shigella dysenteriae strain ATCC 12039 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026831
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026831_1 731619-731822 Orphan NA:I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026831_2 1933391-1933514 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026831_3 2697031-2697122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026831_1 1.5|731762|43|CP026831|CRT 731762-731804 43 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246928-246970 2 0.953
CP026831_2 2.1|1933434|38|CP026831|CRISPRCasFinder 1933434-1933471 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP026831_3 3.1|2697057|40|CP026831|CRISPRCasFinder 2697057-2697096 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
CP026831_1 1.1|731649|31|CP026831|CRISPRCasFinder 731649-731679 31 NC_015512 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence 90200-90230 7 0.774
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 NZ_CP018742 Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence 13806-13836 7 0.774
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 NZ_CP046399 Bacillus sp. A260 plasmid unnamed11, complete sequence 34220-34250 7 0.774
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 50790-50820 8 0.742
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 NZ_CP020079 Vibrio campbellii strain 20130629003S01 plasmid pVCGX2, complete sequence 149847-149877 9 0.71
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 NZ_CP013487 Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence 225034-225064 9 0.71
CP026831_1 1.2|731710|31|CP026831|CRISPRCasFinder 731710-731740 31 NZ_CP019295 Vibrio campbellii strain LMB29 plasmid pLMB157, complete sequence 148571-148601 9 0.71

1. spacer 1.5|731762|43|CP026831|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 2, identity: 0.953 

gataaaccggacgcactggatgcgatgatggatatcacttaga	CRISPR spacer
gataaaccggacgcactggatgcgatgatggacatcacttgga	Protospacer
********************************.*******.**

2. spacer 2.1|1933434|38|CP026831|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.1|2697057|40|CP026831|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95 

gcgctgcggatcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
*********.*****.************************

4. spacer 1.1|731649|31|CP026831|CRISPRCasFinder matches to NC_015512 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY02, complete sequence) position: , mismatch: 7, identity: 0.774 

gcccaggg---atttgttcaatccagcgtgccgc	CRISPR spacer
---caaagtccatttgttcaacccatcgtgccgc	Protospacer
   **..*   **********.*** ********

5. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to NZ_CP018742 (Bacillus cereus strain FORC_047 plasmid pFORC47_2, complete sequence) position: , mismatch: 7, identity: 0.774 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
taatttagaggtgtttattcaaaatcatctt	Protospacer
*. *******.*** ************  *

6. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to NZ_CP046399 (Bacillus sp. A260 plasmid unnamed11, complete sequence) position: , mismatch: 7, identity: 0.774 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
taatttagaggtgtttattcaaaatcatctt	Protospacer
*. *******.*** ************  *

7. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 8, identity: 0.742 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
tcgtttagagtggtgtattcaaaatctttga	Protospacer
*  *******  **************    *

8. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to NZ_CP020079 (Vibrio campbellii strain 20130629003S01 plasmid pVCGX2, complete sequence) position: , mismatch: 9, identity: 0.71 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
tgttttagagctgtgtattaaaacgtttttg	Protospacer
********** ******** ***  .   *.

9. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to NZ_CP013487 (Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence) position: , mismatch: 9, identity: 0.71 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
tgttttagagctgtgtattaaaacgtttttg	Protospacer
********** ******** ***  .   *.

10. spacer 1.2|731710|31|CP026831|CRISPRCasFinder matches to NZ_CP019295 (Vibrio campbellii strain LMB29 plasmid pLMB157, complete sequence) position: , mismatch: 9, identity: 0.71 

tgttttagagatgtgtattcaaaatcagata	CRISPR spacer
tgttttagagctgtgtattaaaacgtttttg	Protospacer
********** ******** ***  .   *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage