Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026795 Shigella boydii strain ATCC BAA-1247 chromosome, complete genome 4 crisprs NA 0 3 0 0
CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 0 crisprs NA 0 0 0 0

Results visualization

1. CP026795
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026795_1 1730158-1730281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026795_2 3245179-3245310 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026795_3 3308743-3308858 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026795_4 3393754-3393895 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026795_3 3.1|3308774|54|CP026795|CRISPRCasFinder 3308774-3308827 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP026795_1 1.1|1730201|38|CP026795|CRISPRCasFinder 1730201-1730238 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4158-4217 7 0.883
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4157-4216 7 0.883
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115798-115857 7 0.883
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4157-4216 7 0.883
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4157-4216 7 0.883
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7435-7494 11 0.817
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84259-84318 11 0.817
CP026795_3 3.1|3308774|54|CP026795|CRISPRCasFinder 3308774-3308827 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP026795_4 4.1|3393795|60|CP026795|CRISPRCasFinder 3393795-3393854 60 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40377-40436 14 0.767

1. spacer 3.1|3308774|54|CP026795|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
*****************************************************

2. spacer 1.1|1730201|38|CP026795|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.883 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaa	CRISPR spacer
ggtgca-caactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaag	Protospacer
 ****. ********************************* ***** **** *******.

4. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.883 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaa	CRISPR spacer
ggtgca-caactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaag	Protospacer
 ****. ********************************* ***** **** *******.

5. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 7, identity: 0.883 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaa	CRISPR spacer
ggtgca-caactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaag	Protospacer
 ****. ********************************* ***** **** *******.

6. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.883 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaa	CRISPR spacer
ggtgca-caactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaag	Protospacer
 ****. ********************************* ***** **** *******.

7. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.883 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttc-ggcacaaa	CRISPR spacer
ggtgca-caactgccggatgcggcgtgaacgccttatccgtcctaccgttcaggcacaag	Protospacer
 ****. ********************************* ***** **** *******.

8. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.817 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaac	CRISPR spacer
ggtgca-caattgccggatgcggcgtgaacgccttatccggcctacggttgagtgcagtt	Protospacer
 ****. ***.*************************************** .*..**. .

9. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.817 

-gtgcgccaactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaac	CRISPR spacer
ggtgca-caattgccggatgcggcgtgaacgccttatccggcctacggttgagtgcagtt	Protospacer
 ****. ***.*************************************** .*..**. .

10. spacer 3.1|3308774|54|CP026795|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** *

11. spacer 4.1|3393795|60|CP026795|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.767 

gtgc-gccaactgccggatgcggcgtgaacgccttatccggcctacggttcggcacaaac	CRISPR spacer
-tacggctttttgccggatgcggcgtaaacgccttatccggcctacggtttggtgcgagt	Protospacer
 *.* **.  .***************.***********************.**..*.*..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage