Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026799 Shigella flexneri strain NCTC 9728 chromosome, complete genome 6 crisprs NA 0 2 0 0
CP026800 Shigella flexneri strain NCTC 9728 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026799
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_1 469991-470092 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_2 1354755-1354872 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_3 1948298-1948421 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_4 2240217-2240360 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_5 2714438-2714586 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026799_6 3583271-3583382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026799_3 3.1|1948341|38|CP026799|CRISPRCasFinder 1948341-1948378 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP026799_6 6.1|3583298|58|CP026799|CRISPRCasFinder 3583298-3583355 58 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101181-101238 12 0.793

1. spacer 3.1|1948341|38|CP026799|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 6.1|3583298|58|CP026799|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.793

aaagcgcatccggcattcaacgcctgatgcgacgctagcgcgtcttatcaggcctacg	CRISPR spacer
ggtaacaatccggcattcagcgcctgatgcgacgctggcgcgtcttatcaggccttgt	Protospacer
.. .   ************.****************.******************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage