Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026377 Pantoea gaviniae strain DSM 22758 chromosome, complete genome 8 crisprs cas3,DinG,DEDDh,csa3 1 1 7 0

Results visualization

1. CP026377
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_2 1383075-1383147 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_3 1506709-1506790 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_4 1900891-1900961 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_6 2286459-2286556 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_7 3412294-3412375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_8 3496147-3496287 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_9 3499346-3499454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026377_10 3543410-3543499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026377_2 2.1|1383098|27|CP026377|CRISPRCasFinder 1383098-1383124 27 CP026377.1 1383047-1383073 1 0.963

1. spacer 2.1|1383098|27|CP026377|CRISPRCasFinder matches to position: 1383047-1383073, mismatch: 1, identity: 0.963

agcgggcgtaaaggcttaaggtgacga	CRISPR spacer
agcgggcgtaaaggattaaggtgacga	Protospacer
************** ************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026377_8 8.2|3496229|36|CP026377|CRISPRCasFinder 3496229-3496264 36 MH697580 Gordonia phage Catfish, complete genome 36284-36319 10 0.722

1. spacer 8.2|3496229|36|CP026377|CRISPRCasFinder matches to MH697580 (Gordonia phage Catfish, complete genome) position: , mismatch: 10, identity: 0.722

taggcgccgttagccgacgggcgcagaccgaagtga	CRISPR spacer
cgctcgccgttctccgacgggcgcagaccgaacccg	Protospacer
..  *******  ******************* . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2068336 : 2081736 14 Tupanvirus(11.11%) tRNA NA
DBSCAN-SWA_2 2503504 : 2512777 13 uncultured_Caudovirales_phage(22.22%) lysis NA
DBSCAN-SWA_3 2576475 : 2584712 10 Erwinia_phage(75.0%) integrase attL 2570004:2570018|attR 2588920:2588934
DBSCAN-SWA_4 3156596 : 3239977 99 Salmonella_phage(25.93%) head,tRNA,terminase,holin,integrase,tail attL 3157461:3157477|attR 3193655:3193671
DBSCAN-SWA_5 3561775 : 3571151 8 Mycobacterium_phage(16.67%) NA NA
DBSCAN-SWA_6 3873369 : 3876908 8 Erwinia_phage(57.14%) integrase attL 3863014:3863063|attR 3879029:3879078
DBSCAN-SWA_7 4059127 : 4071718 13 uncultured_Caudovirales_phage(55.56%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage