Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023270 Achromobacter spanius strain MYb73 chromosome, complete genome 4 crisprs DEDDh,DinG,csa3,WYL 1 0 3 1

Results visualization

1. CP023270
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023270_1 657596-657690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023270_2 2347841-2347935 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023270_3 5558821-5558948 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023270_4 5865507-5865636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP023270_3 3.1|5558868|34|CP023270|CRISPRCasFinder 5558868-5558901 34 CP023270.1 1515224-1515257 1 0.971
CP023270_3 3.1|5558868|34|CP023270|CRISPRCasFinder 5558868-5558901 34 CP023270.1 3897633-3897666 1 0.971
CP023270_3 3.1|5558868|34|CP023270|CRISPRCasFinder 5558868-5558901 34 CP023270.1 5558788-5558821 1 0.971
CP023270_3 3.1|5558868|34|CP023270|CRISPRCasFinder 5558868-5558901 34 CP023270.1 1515408-1515441 2 0.941

1. spacer 3.1|5558868|34|CP023270|CRISPRCasFinder matches to position: 1515224-1515257, mismatch: 1, identity: 0.971

gccccgccgctcggccgcccgaaggcggggcagc	CRISPR spacer
gccccgccgcccggccgcccgaaggcggggcagc	Protospacer
**********.***********************

2. spacer 3.1|5558868|34|CP023270|CRISPRCasFinder matches to position: 3897633-3897666, mismatch: 1, identity: 0.971

gccccgccgctcggccgcccgaaggcggggcagc	CRISPR spacer
gccccgccgcccggccgcccgaaggcggggcagc	Protospacer
**********.***********************

3. spacer 3.1|5558868|34|CP023270|CRISPRCasFinder matches to position: 5558788-5558821, mismatch: 1, identity: 0.971

gccccgccgctcggccgcccgaaggcggggcagc	CRISPR spacer
gccccgccgcccggccgcccgaaggcggggcagc	Protospacer
**********.***********************

4. spacer 3.1|5558868|34|CP023270|CRISPRCasFinder matches to position: 1515408-1515441, mismatch: 2, identity: 0.941

gccccgccgctcggccgcccgaaggcggggcagc	CRISPR spacer
gccccgtcgcccggccgcccgaaggcggggcagc	Protospacer
******.***.***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2841973 : 2849666 9 Moraxella_phage(33.33%) tRNA NA
DBSCAN-SWA_2 3106622 : 3170513 54 Leptospira_phage(25.0%) integrase,transposase attL 3125087:3125103|attR 3183779:3183795
DBSCAN-SWA_3 5555988 : 5626245 67 Burkholderia_phage(25.93%) tRNA,tail,portal,head,terminase,capsid NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP023270.1|AVJ30125.1|5578430_5578721_+|hypothetical-protein 5578430_5578721_+ 96 aa aa NA NA NA 5555988-5626245 yes