Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023272 Pseudomonas lurida strain MYb11 chromosome, complete genome 2 crisprs DEDDh,DinG,csa3,cas3,WYL 1 0 6 0

Results visualization

1. CP023272
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023272_1 869585-869683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023272_2 4496317-4496429 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP023272_1 1.1|869612|45|CP023272|CRISPRCasFinder 869612-869656 45 CP023272.1 1360308-1360352 0 1.0
CP023272_1 1.1|869612|45|CP023272|CRISPRCasFinder 869612-869656 45 CP023272.1 1360236-1360280 1 0.978

1. spacer 1.1|869612|45|CP023272|CRISPRCasFinder matches to position: 1360308-1360352, mismatch: 0, identity: 1.0

ccccgacagccgcccgctatctaactgtcaccccgcgatccaact	CRISPR spacer
ccccgacagccgcccgctatctaactgtcaccccgcgatccaact	Protospacer
*********************************************

2. spacer 1.1|869612|45|CP023272|CRISPRCasFinder matches to position: 1360236-1360280, mismatch: 1, identity: 0.978

ccccgacagccgcccgctatctaactgtcaccccgcgatccaact	CRISPR spacer
ccccgacagccgcccgctatctacctgtcaccccgcgatccaact	Protospacer
*********************** *********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 200171 : 208577 11 Pseudomonas_phage(88.89%) tail NA
DBSCAN-SWA_2 1267887 : 1305194 39 uncultured_Caudovirales_phage(35.0%) holin,plate,tail,tRNA,lysis NA
DBSCAN-SWA_3 1418789 : 1423746 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_4 3650883 : 3660853 12 uncultured_Caudovirales_phage(71.43%) tRNA NA
DBSCAN-SWA_5 5185227 : 5235228 53 Pseudomonas_phage(61.9%) holin,plate,tail,protease,integrase attL 5200284:5200301|attR 5244523:5244540
DBSCAN-SWA_6 5574931 : 5623645 43 Tupanvirus(20.0%) protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage