Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027171 Pseudomonas aeruginosa strain AR_0354 chromosome, complete genome 2 crisprs RT,csa3,DinG,DEDDh,PD-DExK,WYL,cas3 0 3 5 1

Results visualization

1. CP027171
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027171_2 4722505-4722652 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027171_3 5004560-5004673 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027171_1 1.1|3298953|23|CP027171|CRT 3298953-3298975 23 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 13811-13833 0 1.0
CP027171_1 1.1|3298953|23|CP027171|CRT 3298953-3298975 23 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 1066-1088 0 1.0
CP027171_1 1.2|3298997|33|CP027171|CRT 3298997-3299029 33 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 1012-1044 0 1.0
CP027171_1 1.2|3298997|33|CP027171|CRT 3298997-3299029 33 NZ_CP030914 Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence 25270-25302 0 1.0
CP027171_1 1.2|3298997|33|CP027171|CRT 3298997-3299029 33 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 13855-13887 0 1.0
CP027171_1 1.3|3299051|23|CP027171|CRT 3299051-3299073 23 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 13909-13931 0 1.0
CP027171_1 1.3|3299051|23|CP027171|CRT 3299051-3299073 23 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 968-990 0 1.0
CP027171_1 1.1|3298953|23|CP027171|CRT 3298953-3298975 23 NZ_CP030914 Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence 25226-25248 1 0.957
CP027171_1 1.3|3299051|23|CP027171|CRT 3299051-3299073 23 NZ_CP030914 Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence 25324-25346 2 0.913
CP027171_1 1.3|3299051|23|CP027171|CRT 3299051-3299073 23 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 399737-399759 4 0.826

1. spacer 1.1|3298953|23|CP027171|CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 0, identity: 1.0

cccgatctacctcattcaacccc	CRISPR spacer
cccgatctacctcattcaacccc	Protospacer
***********************

2. spacer 1.1|3298953|23|CP027171|CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 0, identity: 1.0

cccgatctacctcattcaacccc	CRISPR spacer
cccgatctacctcattcaacccc	Protospacer
***********************

3. spacer 1.2|3298997|33|CP027171|CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaatcagcggcaagcaatgcgctttaccgct	CRISPR spacer
tgaaatcagcggcaagcaatgcgctttaccgct	Protospacer
*********************************

4. spacer 1.2|3298997|33|CP027171|CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaatcagcggcaagcaatgcgctttaccgct	CRISPR spacer
tgaaatcagcggcaagcaatgcgctttaccgct	Protospacer
*********************************

5. spacer 1.2|3298997|33|CP027171|CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 0, identity: 1.0

tgaaatcagcggcaagcaatgcgctttaccgct	CRISPR spacer
tgaaatcagcggcaagcaatgcgctttaccgct	Protospacer
*********************************

6. spacer 1.3|3299051|23|CP027171|CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 0, identity: 1.0

acagaatccgccgagtacgccct	CRISPR spacer
acagaatccgccgagtacgccct	Protospacer
***********************

7. spacer 1.3|3299051|23|CP027171|CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 0, identity: 1.0

acagaatccgccgagtacgccct	CRISPR spacer
acagaatccgccgagtacgccct	Protospacer
***********************

8. spacer 1.1|3298953|23|CP027171|CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 1, identity: 0.957

cccgatctacctcattcaacccc	CRISPR spacer
cccgatctaccccattcaacccc	Protospacer
***********.***********

9. spacer 1.3|3299051|23|CP027171|CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 2, identity: 0.913

acagaatccgccgagtacgccct	CRISPR spacer
aaaaaatccgccgagtacgccct	Protospacer
* *.*******************

10. spacer 1.3|3299051|23|CP027171|CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 4, identity: 0.826

acagaatccgccgagtacgccct	CRISPR spacer
ggtgaatccgccgagtacgccca	Protospacer
.  ******************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 301109 : 340542 27 Acinetobacter_phage(20.0%) integrase,transposase attL 324660:324719|attR 342358:344232
DBSCAN-SWA_2 533479 : 540373 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_3 4435619 : 4455050 19 Catovirus(25.0%) holin NA
DBSCAN-SWA_4 5296136 : 5348802 56 Pseudomonas_phage(24.0%) tRNA,holin,plate,tail NA
DBSCAN-SWA_5 6086852 : 6095881 9 Bacillus_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP027171.1|AVK14881.1|3351692_3352085_+|hypothetical-protein 3351692_3352085_+ 130 aa aa 3 NA NA No NA