Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027412 Salmonella enterica strain FDAARGOS_319 chromosome, complete genome 3 crisprs DEDDh,WYL,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 36 8 0
CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 0 crisprs csa3 0 0 19 0

Results visualization

1. CP027412
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027412_1 3871758-3871867 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027412_2 4062880-4064542 TypeI-E I-E
26 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027412_3 4080799-4081499 TypeI-E I-E
11 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027412_2 2.8|4063336|28|CP027412|PILER-CR 4063336-4063363 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
CP027412_2 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4063275-4063306 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
CP027412_2 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4063275-4063306 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
CP027412_2 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4063275-4063306 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
CP027412_2 2.14|4063698|32|CP027412|PILER-CR 4063698-4063729 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP027412_2 2.16|4063820|32|CP027412|PILER-CR 4063820-4063851 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
CP027412_2 2.16|4063820|32|CP027412|PILER-CR 4063820-4063851 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
CP027412_2 2.25|4064375|32|CP027412|PILER-CR 4064375-4064406 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
CP027412_2 2.33|4063683|32|CP027412|CRT,CRISPRCasFinder 4063683-4063714 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP027412_2 2.35|4063805|32|CP027412|CRT,CRISPRCasFinder 4063805-4063836 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
CP027412_2 2.35|4063805|32|CP027412|CRT,CRISPRCasFinder 4063805-4063836 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP031397 Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence 50725-50756 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP019854 Borreliella burgdorferi plasmid lp54, complete sequence 50437-50468 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP019765 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence 50437-50468 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NC_011784 Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence 50424-50455 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP017218 Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence 3204-3235 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NC_013130 Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence 50571-50602 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NC_013129 Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence 49716-49747 7 0.781
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NC_001857 Borreliella burgdorferi B31 plasmid lp54, complete sequence 50444-50475 7 0.781
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 MH509446 Gordonia phage DelRio, complete genome 6223-6260 7 0.816
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 325874-325911 7 0.816
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NC_019201 Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence 248-285 7 0.816
CP027412_2 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder 4064360-4064391 32 DQ838728 Lactococcus phage P335, complete genome 1117-1148 7 0.781
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 406309-406339 7 0.774
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1840543-1840573 7 0.774
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1220925-1220955 7 0.774
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 718851-718881 7 0.774
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 911450-911480 7 0.774
CP027412_2 2.2|4062970|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4062970-4063001 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
CP027412_2 2.6|4063214|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4063214-4063245 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
CP027412_2 2.6|4063214|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4063214-4063245 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
CP027412_2 2.15|4063759|32|CP027412|PILER-CR 4063759-4063790 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
CP027412_2 2.19|4064003|32|CP027412|PILER-CR 4064003-4064034 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
CP027412_2 2.19|4064003|32|CP027412|PILER-CR 4064003-4064034 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
CP027412_2 2.25|4064375|32|CP027412|PILER-CR 4064375-4064406 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
CP027412_2 2.34|4063744|32|CP027412|CRT,CRISPRCasFinder 4063744-4063775 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
CP027412_2 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder 4063988-4064019 32 AP013976 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS *** 6246-6277 8 0.75
CP027412_2 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder 4063988-4064019 32 JX536274 Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence 3959-3990 8 0.75
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 336385-336422 8 0.789
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 619925-619962 8 0.789
CP027412_2 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder 4064360-4064391 32 NC_014754 Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence 76425-76456 8 0.75
CP027412_3 3.11|4081438|32|CP027412|CRISPRCasFinder,CRT 4081438-4081469 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353299-353329 8 0.742
CP027412_2 2.11|4063515|32|CP027412|PILER-CR 4063515-4063546 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
CP027412_2 2.25|4064375|32|CP027412|PILER-CR 4064375-4064406 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
CP027412_2 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder 4063500-4063531 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 24080-24111 9 0.719
CP027412_2 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder 4064360-4064391 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 527800-527831 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP043846 Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence 16198-16229 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP034117 Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence 10125-10156 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP034114 Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence 2991-3022 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 177881-177912 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 183537-183568 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 244387-244418 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 180101-180132 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 161475-161506 9 0.719
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 182902-182933 9 0.719
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
CP027412_3 3.3|4080950|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080950-4080981 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
CP027412_3 3.7|4081194|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081194-4081225 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
CP027412_3 3.7|4081194|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081194-4081225 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
CP027412_3 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT 4081377-4081408 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
CP027412_3 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT 4081377-4081408 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
CP027412_3 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT 4081377-4081408 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 AM749121 Streptococcus phage M102 complete genome 7893-7923 9 0.71
CP027412_3 3.12|4081378|31|CP027412|PILER-CR 4081378-4081408 31 NC_012884 Streptococcus phage M102, complete genome 7893-7923 9 0.71
CP027412_2 2.1|4062909|32|CP027412|CRISPRCasFinder,CRT 4062909-4062940 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
CP027412_2 2.1|4062909|32|CP027412|CRISPRCasFinder,CRT 4062909-4062940 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
CP027412_2 2.13|4063637|32|CP027412|PILER-CR 4063637-4063668 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
CP027412_2 2.18|4063942|32|CP027412|PILER-CR 4063942-4063973 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
CP027412_2 2.19|4064003|32|CP027412|PILER-CR 4064003-4064034 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
CP027412_2 2.20|4064064|32|CP027412|PILER-CR 4064064-4064095 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
CP027412_2 2.24|4064308|38|CP027412|PILER-CR 4064308-4064345 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
CP027412_2 2.32|4063622|32|CP027412|CRT,CRISPRCasFinder 4063622-4063653 32 NC_024995 Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119 5043-5074 10 0.688
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
CP027412_2 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder 4063927-4063958 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
CP027412_2 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder 4063988-4064019 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 53255-53286 10 0.688
CP027412_2 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder 4064049-4064080 32 NZ_CP012188 Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence 53401-53432 10 0.688
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 45638-45675 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 47029-47066 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 MN539017 Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence 71631-71668 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 121312-121349 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 MT077888 Escherichia coli plasmid p65, complete sequence 47123-47160 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NC_009838 Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence 46527-46564 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 130757-130794 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 69614-69651 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP048299 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence 195971-196008 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP048303 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence 41259-41296 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 45070-45107 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 239704-239741 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 45070-45107 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NC_019114 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence 43320-43357 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 47029-47066 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 5920-5957 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP043223 Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence 240141-240178 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP027411 Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence 73185-73222 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_KY689633 Escherichia coli strain 100R plasmid p100R, complete sequence 90192-90229 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_KY689632 Escherichia coli strain 19-M12 plasmid p19M12, complete sequence 93444-93481 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP045446 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence 47435-47472 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_KU743384 Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence 181822-181859 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_KU254578 Escherichia coli strain YD786 plasmid pYD786-1, complete sequence 164955-164992 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_KX129782 Escherichia coli strain S38 plasmid pS38, complete sequence 46423-46460 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP015833 Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence 45075-45112 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 LT221036 Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence 41890-41927 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 98508-98545 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP045449 Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence 47434-47471 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 MN732922 Escherichia coli strain 49K plasmid unnamed, complete sequence 70876-70913 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP020493 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence 47990-48027 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP031284 Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence 60929-60966 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP042895 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence 106230-106267 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP022735 Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence 61639-61676 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 CP042898 Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence 125697-125734 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP022165 Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence 45073-45110 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP012931 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence 119613-119650 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 136437-136474 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 46422-46459 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP025402 Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence 182643-182680 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP026933 Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence 46272-46309 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_MH924589 Escherichia coli strain RDB9 plasmid pRDB9, complete sequence 197020-197057 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_MH208235 Escherichia coli strain APECA2 plasmid pJMA2, complete sequence 166860-166897 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_MK169211 Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence 46085-46122 10 0.737
CP027412_2 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder 4064293-4064330 38 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 46814-46851 10 0.737
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP044540 Borrelia sp. CA690 plasmid lp17, complete sequence 10481-10512 10 0.688
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_LR215005 Mycoplasma conjunctivae strain NCTC10147 plasmid 9 126578-126609 10 0.688
CP027412_3 3.1|4080828|32|CP027412|CRISPRCasFinder,CRT 4080828-4080859 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
CP027412_3 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4080889-4080920 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
CP027412_3 3.9|4081316|32|CP027412|CRISPRCasFinder,CRT 4081316-4081347 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
CP027412_2 2.27|4064497|32|CP027412|PILER-CR 4064497-4064528 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656
CP027412_2 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder 4064482-4064513 32 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 45678-45709 11 0.656
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
CP027412_3 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR 4081133-4081164 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.8|4063336|28|CP027412|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  * 

2. spacer 2.11|4063515|32|CP027412|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  . 

3. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  . 

4. spacer 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

5. spacer 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

6. spacer 2.7|4063275|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***  

7. spacer 2.11|4063515|32|CP027412|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

8. spacer 2.11|4063515|32|CP027412|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

9. spacer 2.11|4063515|32|CP027412|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

10. spacer 2.11|4063515|32|CP027412|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

11. spacer 2.14|4063698|32|CP027412|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

12. spacer 2.16|4063820|32|CP027412|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

13. spacer 2.16|4063820|32|CP027412|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

14. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

15. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

16. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

17. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

18. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

19. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

20. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

21. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

22. spacer 2.24|4064308|38|CP027412|PILER-CR matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

23. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

24. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.* 

25. spacer 2.25|4064375|32|CP027412|PILER-CR matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**. 

26. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

27. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

28. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

29. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  . 

30. spacer 2.33|4063683|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

31. spacer 2.35|4063805|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

32. spacer 2.35|4063805|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  * 

33. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP031397 (Borreliella burgdorferi strain MM1 plasmid plsm_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

34. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP019854 (Borreliella burgdorferi plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

35. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP019765 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

36. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NC_011784 (Borreliella burgdorferi ZS7 plasmid ZS7_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

37. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017218 (Borreliella burgdorferi strain B331 plasmid B331_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

38. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NC_013130 (Borreliella burgdorferi N40 plasmid N40_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

39. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NC_013129 (Borreliella burgdorferi JD1 plasmid JD1_lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

40. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NC_001857 (Borreliella burgdorferi B31 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

tgat-gaaatcgtcaataaaattattggcgcgc	CRISPR spacer
-gataaaaatcgtcgataacattattggcgaat	Protospacer
 *** .********.**** ********** ..

41. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtttcggtctcggtcgcggtctcggtgccctcg	Protospacer
*******.************ **********. .  **

42. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tcgcggtctcggtctcggtctcggtcttgtcggcggcg	Protospacer
** ************************.* ..*.*.**

43. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 7, identity: 0.816

tctcggtctcggtctcggtctcggtctcg-gtagtgacg	CRISPR spacer
gctcggtctcagtctcggtctcagtctcgcgtgggggc-	Protospacer
 *********.***********.****** **.* *.* 

44. spacer 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder matches to DQ838728 (Lactococcus phage P335, complete genome) position: , mismatch: 7, identity: 0.781

attttatttgacaaattggcggcatctcactg-	CRISPR spacer
ttgttatttcagaaattggcggcatc-cgctat	Protospacer
 * ****** * ************** *.**. 

45. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

46. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ggcggcggtgaaaggatcggcggtgatgccgg	Protospacer
**  .* .**** ********* *********

47. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

48. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

49. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

50. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

51. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

52. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

53. spacer 2.2|4062970|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

54. spacer 2.6|4063214|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

55. spacer 2.6|4063214|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

56. spacer 2.15|4063759|32|CP027412|PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.     

57. spacer 2.19|4064003|32|CP027412|PILER-CR matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

58. spacer 2.19|4064003|32|CP027412|PILER-CR matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

59. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* . 

60. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

61. spacer 2.25|4064375|32|CP027412|PILER-CR matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

62. spacer 2.34|4063744|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.     

63. spacer 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder matches to AP013976 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7-MedDCM-OCT-S26-C28, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

64. spacer 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder matches to JX536274 (Uncultured Mediterranean phage MEDS5 group fosmid MedDCM-OCT-S15-C5, complete sequence) position: , mismatch: 8, identity: 0.75

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
agttgcgccagcttgatccagtgctgatgcgt	Protospacer
 ******.*** ************    *** 

65. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tctcggtctcggtctcggtctcggtctcgacgacgctt	Protospacer
*****************************.....* . 

66. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.789

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
cctcggtctcggcctcggcctcggtctcggcctcggcg	Protospacer
.***********.*****.***********.  .*.**

67. spacer 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder matches to NC_014754 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU01, complete sequence) position: , mismatch: 8, identity: 0.75

attttatttgacaaattggcggcatctcactg	CRISPR spacer
cctttttttgtcaaattggcggcatacggctg	Protospacer
 .*** **** ************** . .***

68. spacer 3.11|4081438|32|CP027412|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

69. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.742

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttcagtggacgaggagttcctcacccgcacc	Protospacer
.   ************** **** ****  *

70. spacer 2.11|4063515|32|CP027412|PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******   

71. spacer 2.18|4063942|32|CP027412|PILER-CR matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.    

72. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********  

73. spacer 2.25|4064375|32|CP027412|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

74. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

75. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

76. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

77. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

78. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

79. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************  

80. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

81. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

82. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

83. spacer 2.30|4063500|32|CP027412|CRT,CRISPRCasFinder matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******   

84. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.    

85. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
aaattggatcgtcaatgaatttattggcgctg	Protospacer
 .** ..*********.** **********  

86. spacer 2.44|4064360|32|CP027412|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

attttatttgacaaattggcggcatctcactg	CRISPR spacer
attctatttgacacattggcggcgccgagcca	Protospacer
***.********* *********..*  .*..

87. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP043846 (Staphylococcus epidermidis strain ATCC 12228 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

88. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP034117 (Staphylococcus epidermidis strain CDC121 plasmid pSTA482, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

89. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP034114 (Staphylococcus epidermidis strain CDC120 plasmid pSTA493, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
cttttttagctttgattttattgatttttaga	Protospacer
 .* .*** * ******************   

90. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

91. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

92. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
tgtaataatcaataattttattgatttttcga	Protospacer
  *. * **** *.****************  

93. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

94. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

95. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719

actgcttatcattgattttattgatttttccc	CRISPR spacer
gttgcttaccattgattatattgataccagcc	Protospacer
..******.******** ******* ..  **

96. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
tcctcctggacaggctgaccgttgacgatctg	Protospacer
     **..**** *********** ******

97. spacer 3.3|4080950|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

accggacaaatcttttttttcctgttcctgtt	CRISPR spacer
gcatcattaatcctttttttcctgttactgta	Protospacer
.*   *. ****.************* **** 

98. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagtttgctgaactgctcggcgctgatgccgg	Protospacer
 .*. .  ***** * ****************

99. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cctgacggtgaaccggtcggcgctgatgccgc	Protospacer
    ** .***** *.*************** 

100. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagggcgtcgaactgatcggcgctcatgccgg	Protospacer
 .* .*  .**** ********** *******

101. spacer 3.7|4081194|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

102. spacer 3.7|4081194|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******... 

103. spacer 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

104. spacer 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

105. spacer 3.10|4081377|32|CP027412|CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

106. spacer 3.12|4081378|31|CP027412|PILER-CR matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.71

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

107. spacer 3.12|4081378|31|CP027412|PILER-CR matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.71

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

108. spacer 2.1|4062909|32|CP027412|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

109. spacer 2.1|4062909|32|CP027412|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

110. spacer 2.13|4063637|32|CP027412|PILER-CR matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

111. spacer 2.18|4063942|32|CP027412|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

112. spacer 2.18|4063942|32|CP027412|PILER-CR matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

113. spacer 2.18|4063942|32|CP027412|PILER-CR matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

114. spacer 2.18|4063942|32|CP027412|PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

115. spacer 2.18|4063942|32|CP027412|PILER-CR matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

116. spacer 2.19|4064003|32|CP027412|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********   

117. spacer 2.20|4064064|32|CP027412|PILER-CR matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

118. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

119. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

120. spacer 2.24|4064308|38|CP027412|PILER-CR matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

121. spacer 2.24|4064308|38|CP027412|PILER-CR matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

122. spacer 2.24|4064308|38|CP027412|PILER-CR matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

123. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

124. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

125. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

126. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

127. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

128. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

129. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

130. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

131. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

132. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

133. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

134. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

135. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

136. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

137. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

138. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

139. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

140. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

141. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

142. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

143. spacer 2.24|4064308|38|CP027412|PILER-CR matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

144. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

145. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

146. spacer 2.24|4064308|38|CP027412|PILER-CR matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

147. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

148. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

149. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

150. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

151. spacer 2.24|4064308|38|CP027412|PILER-CR matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

152. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

153. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

154. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

155. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

156. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

157. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

158. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

159. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

160. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

161. spacer 2.24|4064308|38|CP027412|PILER-CR matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

162. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.******* 

163. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**  

164. spacer 2.32|4063622|32|CP027412|CRT,CRISPRCasFinder matches to NC_024995 (Gluconacetobacter europaeus plasmid pGE3 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 10, identity: 0.688

accgttccggtatgatcgaagatacggcaaac	CRISPR spacer
tcccttccgatatgatcgaagatagtcctgtt	Protospacer
 ** *****.**************   * . .

165. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

166. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

167. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

168. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

169. spacer 2.37|4063927|32|CP027412|CRT,CRISPRCasFinder matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*    

170. spacer 2.38|4063988|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688

cgttgcgtcaggttgatccagtgcgtcagcgg	CRISPR spacer
tcaaacgccaggttgatcaagtgcgtcagatt	Protospacer
.   .**.********** **********   

171. spacer 2.39|4064049|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP012188 (Lactobacillus paracasei strain CAUH35 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tgatgaaatcgtcaataaaattattggcgcgc	CRISPR spacer
tgatgaaattgtcaaaaaaattaagcagcttc	Protospacer
*********.***** *******   .  . *

172. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

173. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

174. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

175. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

176. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

177. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

178. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

179. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

180. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

181. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

182. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

183. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

184. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

185. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

186. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

187. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

188. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

189. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
attcggtatcggtctcggtctcggtctcggattcatca	Protospacer
 .***** **********************   .. *.

190. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

191. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

192. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

193. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

194. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

195. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

196. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

197. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

198. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

199. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

200. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

201. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

202. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

203. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

204. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

205. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

206. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

207. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

208. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

209. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

210. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

211. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

212. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

213. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

214. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

215. spacer 2.43|4064293|38|CP027412|CRT,CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.737

tctcggtctcggtctcggtctcggtctcggtagtgacg	CRISPR spacer
tatcggtatcggtatcggtctcggtctcggattcatca	Protospacer
* ***** ***** ****************   .. *.

216. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP044540 (Borrelia sp. CA690 plasmid lp17, complete sequence) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
cattaaagtcatttattttattggtttttccg	Protospacer
  *    .***** *********.******* 

217. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_LR215005 (Mycoplasma conjunctivae strain NCTC10147 plasmid 9) position: , mismatch: 10, identity: 0.688

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttctttcatcattgattttcttgatttctcaa	Protospacer
 .. .*.************ *******.**  

218. spacer 3.1|4080828|32|CP027412|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********   

219. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

220. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

221. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

222. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

223. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

224. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

225. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

226. spacer 3.2|4080889|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

227. spacer 3.9|4081316|32|CP027412|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **   

228. spacer 2.27|4064497|32|CP027412|PILER-CR matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** .. 

229. spacer 2.46|4064482|32|CP027412|CRT,CRISPRCasFinder matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

actgcttatcattgattttattgatttttccc	CRISPR spacer
ttgatttattattgattttattcattttatta	Protospacer
 . ..****.************ ***** .. 

230. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

231. spacer 3.6|4081133|32|CP027412|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 640871 : 661768 26 Burkholderia_phage(45.0%) plate,tail NA
DBSCAN-SWA_2 1430098 : 1473694 68 Enterobacteria_phage(44.78%) integrase,lysis,portal,tail,protease,coat,terminase attL 1433945:1433990|attR 1473210:1473255
DBSCAN-SWA_3 2077919 : 2085942 10 Dickeya_phage(14.29%) protease,integrase,transposase attL 2079170:2079184|attR 2091322:2091336
DBSCAN-SWA_4 2136551 : 2234510 107 Salmonella_phage(46.55%) lysis,portal,tail,transposase,protease,terminase,tRNA NA
DBSCAN-SWA_5 3133633 : 3144234 13 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_6 3230229 : 3240735 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 3309011 : 3318182 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 3390232 : 3402516 10 Salmonella_phage(40.0%) holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027411
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 31294 26 Burkholderia_phage(22.22%) transposase NA
DBSCAN-SWA_2 38265 : 47196 10 Caulobacter_phage(33.33%) NA NA
DBSCAN-SWA_3 58539 : 59715 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_4 79454 : 81239 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 95144 : 98161 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_6 101266 : 102271 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_7 118634 : 131303 12 Salmonella_phage(44.44%) transposase NA
DBSCAN-SWA_8 136069 : 137125 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_9 142169 : 143920 3 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_10 149279 : 150074 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_11 156113 : 156407 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_12 161421 : 163223 2 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_13 172460 : 173642 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_14 191128 : 192418 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_15 197116 : 198794 2 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_16 205752 : 207910 2 Pacmanvirus(50.0%) NA NA
DBSCAN-SWA_17 212809 : 214887 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_18 219981 : 227238 5 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_19 230610 : 231291 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage