Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027434 Microbacterium sp. str. 'China' chromosome, complete genome 3 crisprs WYL,csa3,cas3,DEDDh 0 1 2 0

Results visualization

1. CP027434
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027434_1 416542-416671 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027434_2 656075-656149 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027434_3 3306099-3306211 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027434_2 2.1|656098|29|CP027434|CRISPRCasFinder 656098-656126 29 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 625330-625358 5 0.828
CP027434_2 2.1|656098|29|CP027434|CRISPRCasFinder 656098-656126 29 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1395255-1395283 5 0.828
CP027434_2 2.1|656098|29|CP027434|CRISPRCasFinder 656098-656126 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 320017-320045 6 0.793
CP027434_2 2.1|656098|29|CP027434|CRISPRCasFinder 656098-656126 29 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 543652-543680 8 0.724

1. spacer 2.1|656098|29|CP027434|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gaggtcggcgacccagagaaggtcggcga	CRISPR spacer
tatttcggcgacccggagaagggcggcga	Protospacer
 *  **********.******* ******

2. spacer 2.1|656098|29|CP027434|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828

gaggtcggcgacccagagaaggtcggcga	CRISPR spacer
caggtcggcgacgcagagacggtcgtcta	Protospacer
 *********** ****** ***** * *

3. spacer 2.1|656098|29|CP027434|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

gaggtcggcgacccagagaaggtcggcga	CRISPR spacer
aatgccggcgacccagagaacggcggcgt	Protospacer
.* *.*************** * ***** 

4. spacer 2.1|656098|29|CP027434|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 8, identity: 0.724

gaggtcggcgacccagagaaggtcggcga	CRISPR spacer
cgttccggcggccaagagaaggtcggcgt	Protospacer
 .  .*****.** ************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1522473 : 1530914 10 Mycobacterium_phage(66.67%) NA NA
DBSCAN-SWA_2 1540845 : 1551209 12 Rathayibacter_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage