1. spacer 4.3|672445|28|CP027241|CRT matches to KX456211 (Lactococcus phage 63301, complete genome) position: , mismatch: 2, identity: 0.929
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcga Protospacer
************.** ************
2. spacer 4.3|672445|28|CP027241|CRT matches to KX160215 (Lactococcus phage 98104, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
3. spacer 4.3|672445|28|CP027241|CRT matches to KX160205 (Lactococcus phage 49801, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
4. spacer 4.3|672445|28|CP027241|CRT matches to KX160207 (Lactococcus phage 53801, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
5. spacer 4.3|672445|28|CP027241|CRT matches to KX160212 (Lactococcus phage 98101, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
6. spacer 4.3|672445|28|CP027241|CRT matches to AF323670 (Bacteriophage bIL309, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
7. spacer 4.3|672445|28|CP027241|CRT matches to NC_002668 (Lactococcus prophage bIL309, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
8. spacer 4.3|672445|28|CP027241|CRT matches to KX160214 (Lactococcus phage 98103, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
9. spacer 4.3|672445|28|CP027241|CRT matches to KX160213 (Lactococcus phage 98102, complete genome) position: , mismatch: 3, identity: 0.893
atccgtcatatatgcgccatgcttgcga CRISPR spacer
atccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
10. spacer 2.5|513756|24|CP027241|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.833
ttgcggctgaccaccctgcgggta CRISPR spacer
ccgcggctgaccaccctgccggtc Protospacer
..***************** ***
11. spacer 4.3|672445|28|CP027241|CRT matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 4, identity: 0.857
atccgtcatatatgcgccatgcttgcga CRISPR spacer
ttcggtcatatatgcgccatgtttgcgg Protospacer
** *****************.*****.
12. spacer 4.3|672445|28|CP027241|CRT matches to KJ564038 (Lactobacillus phage Ld3, complete genome) position: , mismatch: 4, identity: 0.857
atccgtcatatatgcgccatgcttgcga CRISPR spacer
gtctgtcatataagcgccatgcttgcgg Protospacer
.**.******** **************.
13. spacer 4.3|672445|28|CP027241|CRT matches to KJ564036 (Lactobacillus phage Ld25A, complete genome) position: , mismatch: 4, identity: 0.857
atccgtcatatatgcgccatgcttgcga CRISPR spacer
gtctgtcatataagcgccatgcttgcgg Protospacer
.**.******** **************.
14. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160207 (Lactococcus phage 53801, complete genome) position: , mismatch: 4, identity: 0.867
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gtatccgtcatatacgctccatgcttgcgg Protospacer
*************.** ***********.
15. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX456211 (Lactococcus phage 63301, complete genome) position: , mismatch: 4, identity: 0.867
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gcatccgtcatatacgctccatgcttgcga Protospacer
.************.** ************
16. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160215 (Lactococcus phage 98104, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
17. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160205 (Lactococcus phage 49801, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
18. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160212 (Lactococcus phage 98101, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
19. spacer 4.7|672443|30|CP027241|PILER-CR matches to AF323670 (Bacteriophage bIL309, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
20. spacer 4.7|672443|30|CP027241|PILER-CR matches to NC_002668 (Lactococcus prophage bIL309, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
21. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160214 (Lactococcus phage 98103, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
22. spacer 4.7|672443|30|CP027241|PILER-CR matches to KX160213 (Lactococcus phage 98102, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
gaatccgtcatatacgctccatgcttgcgg Protospacer
************.** ***********.
23. spacer 4.7|672443|30|CP027241|PILER-CR matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
tgttcggtcatatatgcgccatgtttgcgg Protospacer
* ** *****************.*****.
24. spacer 4.7|672443|30|CP027241|PILER-CR matches to KJ564038 (Lactobacillus phage Ld3, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
tggtctgtcatataagcgccatgcttgcgg Protospacer
* .**.******** **************.
25. spacer 4.7|672443|30|CP027241|PILER-CR matches to KJ564036 (Lactobacillus phage Ld25A, complete genome) position: , mismatch: 5, identity: 0.833
ttatccgtcatatatgcgccatgcttgcga CRISPR spacer
tggtctgtcatataagcgccatgcttgcgg Protospacer
* .**.******** **************.
26. spacer 4.4|672511|28|CP027241|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
ggaaatcaatctcgctatctggggtgat Protospacer
. **************** **.****
27. spacer 4.4|672511|28|CP027241|CRT matches to HC001412 (Sequence 17 from Patent WO2009106635) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
28. spacer 4.4|672511|28|CP027241|CRT matches to HI551563 (Sequence 3 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
29. spacer 4.4|672511|28|CP027241|CRT matches to FJ881694 (Enterobacteria phage T7 RNA polymerase gene, complete cds) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
30. spacer 4.4|672511|28|CP027241|CRT matches to HI551621 (Sequence 61 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
31. spacer 4.4|672511|28|CP027241|CRT matches to LF398928 (JP 2014528730-A/1: RNA polymerase mutants) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
32. spacer 4.4|672511|28|CP027241|CRT matches to HI551583 (Sequence 23 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
33. spacer 4.4|672511|28|CP027241|CRT matches to HI551565 (Sequence 5 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
34. spacer 4.4|672511|28|CP027241|CRT matches to HW374671 (JP 2012223202-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
35. spacer 4.4|672511|28|CP027241|CRT matches to HI551575 (Sequence 15 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
36. spacer 4.4|672511|28|CP027241|CRT matches to HI551579 (Sequence 19 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
37. spacer 4.4|672511|28|CP027241|CRT matches to HI551599 (Sequence 39 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
38. spacer 4.4|672511|28|CP027241|CRT matches to JA821311 (Sequence 47 from Patent EP2284268) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
39. spacer 4.4|672511|28|CP027241|CRT matches to HW805501 (JP 2015015955-A/8: CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
40. spacer 4.4|672511|28|CP027241|CRT matches to DQ100054 (Bacteriophage T7.1 section alpha sequence) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
41. spacer 4.4|672511|28|CP027241|CRT matches to LP718681 (Sequence 176 from Patent EP2885419) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
42. spacer 4.4|672511|28|CP027241|CRT matches to HI551607 (Sequence 47 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
43. spacer 4.4|672511|28|CP027241|CRT matches to HV235491 (JP 2009213497-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
44. spacer 4.4|672511|28|CP027241|CRT matches to HV701371 (JP 2012075418-A/5: Improved RNA polymerase mutant) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
45. spacer 4.4|672511|28|CP027241|CRT matches to HI551585 (Sequence 25 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
46. spacer 4.4|672511|28|CP027241|CRT matches to HI551577 (Sequence 17 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
47. spacer 4.4|672511|28|CP027241|CRT matches to HI551595 (Sequence 35 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
48. spacer 4.4|672511|28|CP027241|CRT matches to HI551619 (Sequence 59 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
49. spacer 4.4|672511|28|CP027241|CRT matches to HI551597 (Sequence 37 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
50. spacer 4.4|672511|28|CP027241|CRT matches to DM025976 (Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
51. spacer 4.4|672511|28|CP027241|CRT matches to E43997 (Improved RNA polymerase) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
52. spacer 4.4|672511|28|CP027241|CRT matches to HI551581 (Sequence 21 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
53. spacer 4.4|672511|28|CP027241|CRT matches to HI551571 (Sequence 11 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
54. spacer 4.4|672511|28|CP027241|CRT matches to HV547440 (JP 2011224013-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
55. spacer 4.4|672511|28|CP027241|CRT matches to MP478605 (Sequence 40 from Patent WO2020012335) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
56. spacer 4.4|672511|28|CP027241|CRT matches to HI551593 (Sequence 33 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
57. spacer 4.4|672511|28|CP027241|CRT matches to AY264774 (Enterobacteria phage T7, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
58. spacer 4.4|672511|28|CP027241|CRT matches to AY264775 (Enterobacteria phage T7 isolate K, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
59. spacer 4.4|672511|28|CP027241|CRT matches to HI551615 (Sequence 55 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
60. spacer 4.4|672511|28|CP027241|CRT matches to HI551605 (Sequence 45 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
61. spacer 4.4|672511|28|CP027241|CRT matches to HI551611 (Sequence 51 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
62. spacer 4.4|672511|28|CP027241|CRT matches to HI551567 (Sequence 7 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
63. spacer 4.4|672511|28|CP027241|CRT matches to HV235493 (JP 2009213499-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
64. spacer 4.4|672511|28|CP027241|CRT matches to HI551561 (Sequence 1 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
65. spacer 4.4|672511|28|CP027241|CRT matches to MG833025 (Mutant Enterobacteria phage T7 strain T7Del1revsplitRNAP, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
66. spacer 4.4|672511|28|CP027241|CRT matches to AY264776 (Enterobacteria phage T7 isolate K115, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
67. spacer 4.4|672511|28|CP027241|CRT matches to CS086837 (Sequence 3 from Patent WO2005040388) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
68. spacer 4.4|672511|28|CP027241|CRT matches to V01127 (Left end of bacteriophage T7 genome. Includes the reading frames of the genes 0.3, 0.4, 0.5, 0.6, 0.65, 0.7, 1, 1.1, 1.2, 1.3 (early proteins) and 1.4, 1.5, 1.6, 1.7, 2, 2.5, 2.8, 3, 3.5, 4A and 4B (late proteins). Gene 1 is the T7 RNA polymerase) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
69. spacer 4.4|672511|28|CP027241|CRT matches to HI551569 (Sequence 9 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
70. spacer 4.4|672511|28|CP027241|CRT matches to DD451662 (Method for detecting the interaction of protein) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
71. spacer 4.4|672511|28|CP027241|CRT matches to HZ771599 (JP 2015003913-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
72. spacer 4.4|672511|28|CP027241|CRT matches to HI551601 (Sequence 41 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
73. spacer 4.4|672511|28|CP027241|CRT matches to NC_042057 (Enterobacteria phage DE3, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
74. spacer 4.4|672511|28|CP027241|CRT matches to HI551617 (Sequence 57 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
75. spacer 4.4|672511|28|CP027241|CRT matches to JA842209 (Sequence 47 from Patent EP2316942) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
76. spacer 4.4|672511|28|CP027241|CRT matches to AY264778 (Enterobacteria phage T7 isolate P82, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
77. spacer 4.4|672511|28|CP027241|CRT matches to DM465311 (RNA Polymerase Mutant With Improved Function) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
78. spacer 4.4|672511|28|CP027241|CRT matches to M38308 (Bacteriophage T7 RNA polymerase gene, complete cds) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
79. spacer 4.4|672511|28|CP027241|CRT matches to HV703014 (JP 2012080889-A/2: Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
80. spacer 4.4|672511|28|CP027241|CRT matches to DM139659 (Compositions, Methods and Kits for Real-Time Nucleic Acid Analysis in Live Cells) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
81. spacer 4.4|672511|28|CP027241|CRT matches to HV703015 (JP 2012080889-A/3: Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
82. spacer 4.4|672511|28|CP027241|CRT matches to HI551587 (Sequence 27 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
83. spacer 4.4|672511|28|CP027241|CRT matches to GM604318 (Sequence 8 from Patent EP1939214) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
84. spacer 4.4|672511|28|CP027241|CRT matches to LQ979057 (Sequence 1 from Patent WO2013050609) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
85. spacer 4.4|672511|28|CP027241|CRT matches to HV235492 (JP 2009213498-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
86. spacer 4.4|672511|28|CP027241|CRT matches to AY264777 (Enterobacteria phage T7 isolate P, complete genome) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
87. spacer 4.4|672511|28|CP027241|CRT matches to HC768866 (Sequence 17 from Patent WO2010049807) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
88. spacer 4.4|672511|28|CP027241|CRT matches to GM677256 (Sequence 8 from Patent WO2008078198) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
89. spacer 4.4|672511|28|CP027241|CRT matches to CS038863 (Sequence 1 from Patent EP1512742) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
90. spacer 4.4|672511|28|CP027241|CRT matches to HV029889 (JP 2011051943-A/5: Protein extraction reagent and method for screening polymerase using the same) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
91. spacer 4.4|672511|28|CP027241|CRT matches to FW366198 (CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
92. spacer 4.4|672511|28|CP027241|CRT matches to HI551609 (Sequence 49 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
93. spacer 4.4|672511|28|CP027241|CRT matches to HW805502 (JP 2015015955-A/9: CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
94. spacer 4.4|672511|28|CP027241|CRT matches to HI551603 (Sequence 43 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
95. spacer 4.4|672511|28|CP027241|CRT matches to HI551591 (Sequence 31 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
96. spacer 4.4|672511|28|CP027241|CRT matches to HV701390 (JP 2012075418-A/24: Improved RNA polymerase mutant) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
97. spacer 4.4|672511|28|CP027241|CRT matches to FW343405 (Expression vector for multiple gene expression) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
98. spacer 4.4|672511|28|CP027241|CRT matches to V01146 (Genome of bacteriophage T7) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
99. spacer 4.4|672511|28|CP027241|CRT matches to LR745708 (Escherichia phage T7 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
100. spacer 4.4|672511|28|CP027241|CRT matches to HI551613 (Sequence 53 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
101. spacer 4.4|672511|28|CP027241|CRT matches to LY802968 (KR 1020200018071-A/1: Modified pT7/T7 polymerase system for sustainable shRNA expression in cytoplasm and liposome transporter comprising it) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
102. spacer 4.4|672511|28|CP027241|CRT matches to CS086836 (Sequence 2 from Patent WO2005040388) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
103. spacer 4.4|672511|28|CP027241|CRT matches to HI551589 (Sequence 29 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
104. spacer 4.4|672511|28|CP027241|CRT matches to GM604320 (Sequence 10 from Patent EP1939214) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
105. spacer 4.4|672511|28|CP027241|CRT matches to JA866434 (Sequence 47 from Patent EP2270162) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
106. spacer 4.4|672511|28|CP027241|CRT matches to LQ307592 (Sequence 177 from Patent WO2016049492) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
107. spacer 4.4|672511|28|CP027241|CRT matches to GM677258 (Sequence 10 from Patent WO2008078198) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
108. spacer 4.4|672511|28|CP027241|CRT matches to HI551573 (Sequence 13 from Patent EP2185716) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
109. spacer 4.4|672511|28|CP027241|CRT matches to DJ011524 (Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
110. spacer 4.4|672511|28|CP027241|CRT matches to LY802971 (KR 1020200018071-A/4: Modified pT7/T7 polymerase system for sustainable shRNA expression in cytoplasm and liposome transporter comprising it) position: , mismatch: 6, identity: 0.786
taccatcaatctcgctatcttggatgat CRISPR spacer
gtgcatcaatctcgctatctttgttggt Protospacer
****************** * **.*
111. spacer 4.8|672509|30|CP027241|PILER-CR matches to HC001412 (Sequence 17 from Patent WO2009106635) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
112. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551563 (Sequence 3 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
113. spacer 4.8|672509|30|CP027241|PILER-CR matches to FJ881694 (Enterobacteria phage T7 RNA polymerase gene, complete cds) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
114. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551621 (Sequence 61 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
115. spacer 4.8|672509|30|CP027241|PILER-CR matches to LF398928 (JP 2014528730-A/1: RNA polymerase mutants) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
116. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551583 (Sequence 23 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
117. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551565 (Sequence 5 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
118. spacer 4.8|672509|30|CP027241|PILER-CR matches to HW374671 (JP 2012223202-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
119. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551575 (Sequence 15 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
120. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551579 (Sequence 19 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
121. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551599 (Sequence 39 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
122. spacer 4.8|672509|30|CP027241|PILER-CR matches to JA821311 (Sequence 47 from Patent EP2284268) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
123. spacer 4.8|672509|30|CP027241|PILER-CR matches to HW805501 (JP 2015015955-A/8: CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
124. spacer 4.8|672509|30|CP027241|PILER-CR matches to DQ100054 (Bacteriophage T7.1 section alpha sequence) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
125. spacer 4.8|672509|30|CP027241|PILER-CR matches to LP718681 (Sequence 176 from Patent EP2885419) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
126. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551607 (Sequence 47 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
127. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV235491 (JP 2009213497-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
128. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV701371 (JP 2012075418-A/5: Improved RNA polymerase mutant) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
129. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551585 (Sequence 25 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
130. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551577 (Sequence 17 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
131. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551595 (Sequence 35 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
132. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551619 (Sequence 59 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
133. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551597 (Sequence 37 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
134. spacer 4.8|672509|30|CP027241|PILER-CR matches to DM025976 (Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
135. spacer 4.8|672509|30|CP027241|PILER-CR matches to E43997 (Improved RNA polymerase) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
136. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551581 (Sequence 21 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
137. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551571 (Sequence 11 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
138. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV547440 (JP 2011224013-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
139. spacer 4.8|672509|30|CP027241|PILER-CR matches to MP478605 (Sequence 40 from Patent WO2020012335) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
140. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551593 (Sequence 33 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
141. spacer 4.8|672509|30|CP027241|PILER-CR matches to AY264774 (Enterobacteria phage T7, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
142. spacer 4.8|672509|30|CP027241|PILER-CR matches to AY264775 (Enterobacteria phage T7 isolate K, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
143. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551615 (Sequence 55 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
144. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551605 (Sequence 45 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
145. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551611 (Sequence 51 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
146. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551567 (Sequence 7 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
147. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV235493 (JP 2009213499-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
148. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551561 (Sequence 1 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
149. spacer 4.8|672509|30|CP027241|PILER-CR matches to MG833025 (Mutant Enterobacteria phage T7 strain T7Del1revsplitRNAP, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
150. spacer 4.8|672509|30|CP027241|PILER-CR matches to AY264776 (Enterobacteria phage T7 isolate K115, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
151. spacer 4.8|672509|30|CP027241|PILER-CR matches to CS086837 (Sequence 3 from Patent WO2005040388) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
152. spacer 4.8|672509|30|CP027241|PILER-CR matches to V01127 (Left end of bacteriophage T7 genome. Includes the reading frames of the genes 0.3, 0.4, 0.5, 0.6, 0.65, 0.7, 1, 1.1, 1.2, 1.3 (early proteins) and 1.4, 1.5, 1.6, 1.7, 2, 2.5, 2.8, 3, 3.5, 4A and 4B (late proteins). Gene 1 is the T7 RNA polymerase) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
153. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551569 (Sequence 9 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
154. spacer 4.8|672509|30|CP027241|PILER-CR matches to DD451662 (Method for detecting the interaction of protein) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
155. spacer 4.8|672509|30|CP027241|PILER-CR matches to HZ771599 (JP 2015003913-A/47: Conserved HBV and HCV Sequences Useful for Gene Silencing) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
156. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551601 (Sequence 41 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
157. spacer 4.8|672509|30|CP027241|PILER-CR matches to NC_042057 (Enterobacteria phage DE3, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
158. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551617 (Sequence 57 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
159. spacer 4.8|672509|30|CP027241|PILER-CR matches to JA842209 (Sequence 47 from Patent EP2316942) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
160. spacer 4.8|672509|30|CP027241|PILER-CR matches to AY264778 (Enterobacteria phage T7 isolate P82, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
161. spacer 4.8|672509|30|CP027241|PILER-CR matches to DM465311 (RNA Polymerase Mutant With Improved Function) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
162. spacer 4.8|672509|30|CP027241|PILER-CR matches to M38308 (Bacteriophage T7 RNA polymerase gene, complete cds) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
163. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV703014 (JP 2012080889-A/2: Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
164. spacer 4.8|672509|30|CP027241|PILER-CR matches to DM139659 (Compositions, Methods and Kits for Real-Time Nucleic Acid Analysis in Live Cells) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
165. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV703015 (JP 2012080889-A/3: Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
166. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551587 (Sequence 27 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
167. spacer 4.8|672509|30|CP027241|PILER-CR matches to GM604318 (Sequence 8 from Patent EP1939214) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
168. spacer 4.8|672509|30|CP027241|PILER-CR matches to LQ979057 (Sequence 1 from Patent WO2013050609) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
169. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV235492 (JP 2009213498-A/1: Improved RNA Polymerase) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
170. spacer 4.8|672509|30|CP027241|PILER-CR matches to AY264777 (Enterobacteria phage T7 isolate P, complete genome) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
171. spacer 4.8|672509|30|CP027241|PILER-CR matches to HC768866 (Sequence 17 from Patent WO2010049807) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
172. spacer 4.8|672509|30|CP027241|PILER-CR matches to GM677256 (Sequence 8 from Patent WO2008078198) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
173. spacer 4.8|672509|30|CP027241|PILER-CR matches to CS038863 (Sequence 1 from Patent EP1512742) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
174. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV029889 (JP 2011051943-A/5: Protein extraction reagent and method for screening polymerase using the same) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
175. spacer 4.8|672509|30|CP027241|PILER-CR matches to FW366198 (CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
176. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551609 (Sequence 49 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
177. spacer 4.8|672509|30|CP027241|PILER-CR matches to HW805502 (JP 2015015955-A/9: CELLS AND METHODOLOGY TO GENERATE NON-SEGMENTED NEGATIVE-STRAND RNA VIRUSES) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
178. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551603 (Sequence 43 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
179. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551591 (Sequence 31 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
180. spacer 4.8|672509|30|CP027241|PILER-CR matches to HV701390 (JP 2012075418-A/24: Improved RNA polymerase mutant) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
181. spacer 4.8|672509|30|CP027241|PILER-CR matches to FW343405 (Expression vector for multiple gene expression) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
182. spacer 4.8|672509|30|CP027241|PILER-CR matches to V01146 (Genome of bacteriophage T7) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
183. spacer 4.8|672509|30|CP027241|PILER-CR matches to LR745708 (Escherichia phage T7 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
184. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551613 (Sequence 53 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
185. spacer 4.8|672509|30|CP027241|PILER-CR matches to LY802968 (KR 1020200018071-A/1: Modified pT7/T7 polymerase system for sustainable shRNA expression in cytoplasm and liposome transporter comprising it) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
186. spacer 4.8|672509|30|CP027241|PILER-CR matches to CS086836 (Sequence 2 from Patent WO2005040388) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
187. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551589 (Sequence 29 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
188. spacer 4.8|672509|30|CP027241|PILER-CR matches to GM604320 (Sequence 10 from Patent EP1939214) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
189. spacer 4.8|672509|30|CP027241|PILER-CR matches to JA866434 (Sequence 47 from Patent EP2270162) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
190. spacer 4.8|672509|30|CP027241|PILER-CR matches to LQ307592 (Sequence 177 from Patent WO2016049492) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
191. spacer 4.8|672509|30|CP027241|PILER-CR matches to GM677258 (Sequence 10 from Patent WO2008078198) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
192. spacer 4.8|672509|30|CP027241|PILER-CR matches to HI551573 (Sequence 13 from Patent EP2185716) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
193. spacer 4.8|672509|30|CP027241|PILER-CR matches to DJ011524 (Multiple-Compartment Eukaryotic Expression Systems) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
194. spacer 4.8|672509|30|CP027241|PILER-CR matches to LY802971 (KR 1020200018071-A/4: Modified pT7/T7 polymerase system for sustainable shRNA expression in cytoplasm and liposome transporter comprising it) position: , mismatch: 6, identity: 0.8
-tataccatcaatctcgctatcttggatgat CRISPR spacer
gtgtg-catcaatctcgctatctttgttggt Protospacer
*.*. ****************** * **.*
195. spacer 4.4|672511|28|CP027241|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.75
taccatcaatctcgctatcttggatgat CRISPR spacer
cggcatcaatctcgccatcctggatggg Protospacer
.. ************.***.******.
196. spacer 4.4|672511|28|CP027241|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.75
taccatcaatctcgctatcttggatgat CRISPR spacer
cggcatcaatctcgccatcctggatggg Protospacer
.. ************.***.******.
197. spacer 4.8|672509|30|CP027241|PILER-CR matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.767
tataccatcaatctcgctatcttggatgat CRISPR spacer
tcggaaatcaatctcgctatctggggtgat Protospacer
* . **************** **.****
198. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160207 (Lactococcus phage 53801, complete genome) position: , mismatch: 7, identity: 0.806
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
tatccgtcatatacgctccatgcttgcggattgttg Protospacer
*************.** ***********..** *
199. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160215 (Lactococcus phage 98104, complete genome) position: , mismatch: 8, identity: 0.778
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggattgttg Protospacer
************.** ***********..** *
200. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160205 (Lactococcus phage 49801, complete genome) position: , mismatch: 8, identity: 0.778
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggattgttg Protospacer
************.** ***********..** *
201. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160212 (Lactococcus phage 98101, complete genome) position: , mismatch: 8, identity: 0.778
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggattgttg Protospacer
************.** ***********..** *
202. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160214 (Lactococcus phage 98103, complete genome) position: , mismatch: 8, identity: 0.778
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggattgttg Protospacer
************.** ***********..** *
203. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KX160213 (Lactococcus phage 98102, complete genome) position: , mismatch: 8, identity: 0.778
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggattgttg Protospacer
************.** ***********..** *
204. spacer 4.8|672509|30|CP027241|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.7
tataccatcaatctcgctatcttggatgat CRISPR spacer
agcggcatcaatctcgccatcctggatggg Protospacer
... ************.***.******.
205. spacer 4.8|672509|30|CP027241|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.7
tataccatcaatctcgctatcttggatgat CRISPR spacer
agcggcatcaatctcgccatcctggatggg Protospacer
... ************.***.******.
206. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to AF323670 (Bacteriophage bIL309, complete genome) position: , mismatch: 9, identity: 0.75
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggatagtcg Protospacer
************.** ***********..* *
207. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to NC_002668 (Lactococcus prophage bIL309, complete genome) position: , mismatch: 9, identity: 0.75
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
aatccgtcatatacgctccatgcttgcggatagtcg Protospacer
************.** ***********..* *
208. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 10, identity: 0.722
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
gttcggtcatatatgcgccatgtttgcggattgatg Protospacer
** *****************.*****..**
209. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KJ564038 (Lactobacillus phage Ld3, complete genome) position: , mismatch: 11, identity: 0.694
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
ggtctgtcatataagcgccatgcttgcggatagcgg Protospacer
.**.******** **************..* ..
210. spacer 4.10|672444|36|CP027241|CRISPRCasFinder matches to KJ564036 (Lactobacillus phage Ld25A, complete genome) position: , mismatch: 11, identity: 0.694
tatccgtcatatatgcgccatgcttgcgagttttac CRISPR spacer
ggtctgtcatataagcgccatgcttgcggatagcgg Protospacer
.**.******** **************..* ..