Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021256 Legionella pneumophila strain D-4954 chromosome, complete genome 2 crisprs NA 0 5 0 0

Results visualization

1. CP021256
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021256_1 177103-178910 Orphan NA
25 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021256_2 1680337-1680444 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021256_1 1.15|178131|34|CP021256|PILER-CR,CRISPRCasFinder,CRT 178131-178164 34 NZ_CP021285 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence 35628-35661 2 0.941
CP021256_1 1.3|177282|33|CP021256|PILER-CR,CRISPRCasFinder,CRT 177282-177314 33 NZ_CP010910 Candidatus Pantoea carbekii strain US plasmid pBMSBPS3, complete sequence 6349-6381 6 0.818
CP021256_1 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT 177494-177529 36 MH542234 Staphylococcus phage Terranova, complete genome 23165-23200 8 0.778
CP021256_1 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT 177494-177529 36 MH321490 Staphylococcus phage Quidividi, complete genome 20804-20839 8 0.778
CP021256_1 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT 177494-177529 36 MH321491 Staphylococcus phage Twillingate, complete genome 22950-22985 8 0.778
CP021256_1 1.19|178413|34|CP021256|PILER-CR,CRISPRCasFinder,CRT 178413-178446 34 NC_019775 Anabaena cylindrica PCC 7122 plasmid pANACY.06, complete sequence 3240-3273 8 0.765
CP021256_1 1.11|177850|33|CP021256|PILER-CR,CRISPRCasFinder,CRT 177850-177882 33 NZ_CP047444 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7 21594-21626 9 0.727

1. spacer 1.15|178131|34|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021285 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgacatattagaaaccatggctccaaagctata	CRISPR spacer
gtgacatattagaaaccatggctccaaagctgtt	Protospacer
*******************************.* 

2. spacer 1.3|177282|33|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010910 (Candidatus Pantoea carbekii strain US plasmid pBMSBPS3, complete sequence) position: , mismatch: 6, identity: 0.818

ataaactataatttccacaacacaataaactat	CRISPR spacer
ttaaactataatttttacaacacaataatattt	Protospacer
 *************..************  * *

3. spacer 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to MH542234 (Staphylococcus phage Terranova, complete genome) position: , mismatch: 8, identity: 0.778

tctgttcaccctacacaaaagcccgtagctttaatg	CRISPR spacer
ttattacaccctacacaaaaaccagtagctttattt	Protospacer
*.  * **************.** ********* * 

4. spacer 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to MH321490 (Staphylococcus phage Quidividi, complete genome) position: , mismatch: 8, identity: 0.778

tctgttcaccctacacaaaagcccgtagctttaatg	CRISPR spacer
ttattacaccctacacaaaaaccagtagctttattt	Protospacer
*.  * **************.** ********* * 

5. spacer 1.6|177494|36|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to MH321491 (Staphylococcus phage Twillingate, complete genome) position: , mismatch: 8, identity: 0.778

tctgttcaccctacacaaaagcccgtagctttaatg	CRISPR spacer
ttattacaccctacacaaaaaccagtagctttattt	Protospacer
*.  * **************.** ********* * 

6. spacer 1.19|178413|34|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to NC_019775 (Anabaena cylindrica PCC 7122 plasmid pANACY.06, complete sequence) position: , mismatch: 8, identity: 0.765

atctcatatccagcctctaaattttttagtaaaa	CRISPR spacer
attttttcaccagcttctaatttttttagtaaat	Protospacer
**.*. *  *****.***** ************ 

7. spacer 1.11|177850|33|CP021256|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 9, identity: 0.727

tttctatgttcagttttccaatttattattgac	CRISPR spacer
tgaaactgttcagttttccaatatatttttaat	Protospacer
*     **************** **** **.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage