Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021261 Legionella pneumophila strain NY23 (D-7705) chromosome, complete genome 2 crisprs NA 0 2 0 0

Results visualization

1. CP021261
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021261_1 189549-190451 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021261_2 3177408-3177510 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_AP019741 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence 181525-181555 7 0.774
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 CP032137 Acinetobacter haemolyticus strain sz1652 plasmid unnamed2, complete sequence 12732-12762 7 0.774
CP021261_1 1.4|189803|37|CP021261|CRISPRCasFinder,CRT,PILER-CR 189803-189839 37 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1503160-1503196 8 0.784
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP023033 Acinetobacter baumannii strain 7847 plasmid pAba7847b, complete sequence 13176-13206 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP015366 Acinetobacter baumannii strain 3207 plasmid pAba3207b, complete sequence 13176-13206 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 CP046596 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence 85188-85218 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP038264 Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr6, complete sequence 10129-10159 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP033245 Acinetobacter baumannii strain 7835 plasmid pAba7835b, complete sequence 13175-13205 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP023028 Acinetobacter baumannii strain 10042 plasmid pAba10042b, complete sequence 45800-45830 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_CP042365 Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence 58146-58176 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41991-42021 8 0.742
CP021261_2 2.1|3177444|31|CP021261|CRISPRCasFinder 3177444-3177474 31 HG796278 Uncultured bacterium plasmid pRGI00192 2532-2562 9 0.71

1. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_AP019741 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence) position: , mismatch: 7, identity: 0.774 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ttattgcataatatttaactattgcaaaata	Protospacer
** *  .** ****.***************

2. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to CP032137 (Acinetobacter haemolyticus strain sz1652 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ttattgcataatatttaactattgcaaaata	Protospacer
** *  .** ****.***************

3. spacer 1.4|189803|37|CP021261|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784 

tcagggag---gggcagtgaaaattatggcaaacaagaac	CRISPR spacer
---aggagcccgggcagtgaaaattacggcaaacaagggg	Protospacer
   .****   ***************.**********..

4. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP023033 (Acinetobacter baumannii strain 7847 plasmid pAba7847b, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

5. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP015366 (Acinetobacter baumannii strain 3207 plasmid pAba3207b, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

6. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to CP046596 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

7. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP038264 (Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr6, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

8. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP033245 (Acinetobacter baumannii strain 7835 plasmid pAba7835b, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

9. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP023028 (Acinetobacter baumannii strain 10042 plasmid pAba10042b, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

10. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_CP042365 (Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

11. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 8, identity: 0.742 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.***************

12. spacer 2.1|3177444|31|CP021261|CRISPRCasFinder matches to HG796278 (Uncultured bacterium plasmid pRGI00192) position: , mismatch: 9, identity: 0.71 

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ccgcatttttatatccaactattgcaataaa	Protospacer
.. .*** *******.*********** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage