Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
CP021263 | Legionella pneumophila subsp. fraseri strain D-3137 chromosome, complete genome | 3 crisprs | 0 | 2 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP021263_1 | 200541-201302 | Orphan |
NA
|
10 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP021263_2 | 1732658-1732778 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
CP021263_3 | 2666689-2666861 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
CP021263_3 | 2666791-2666830 | 40 | NZ_LR134418 | Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 | 257659-257698 | 1 | 0.975 | |
CP021263_1 | 201159-201192 | 34 | NZ_CP016745 | Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence | 102474-102507 | 10 | 0.706 | |
CP021263_1 | 201159-201192 | 34 | NZ_CP016746 | Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence | 172093-172126 | 10 | 0.706 |
atggtgaattaatgcaaaaaaatgcaataataaatttatt CRISPR spacer atggtgaattaatgcaaataaatgcaataataaatttatt Protospacer ****************** *********************
cggctggtattacaaggatgcaagacacatggat CRISPR spacer caaaaataattacaaggaggcaagagacatggct Protospacer *.. . ********** ****** ****** *
cggctggtattacaaggatgcaagacacatggat CRISPR spacer caaaaataattacaaggaggcaagagacatggct Protospacer *.. . ********** ****** ****** *
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|