Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021257 Legionella pneumophila subsp. fraseri strain Lansing 3 chromosome, complete genome 4 crisprs NA 0 2 0 0

Results visualization

1. CP021257
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021257_1 206564-207540 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021257_2 628265-628437 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021257_3 664204-664309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021257_4 1633154-1633357 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021257_2 2.1|628296|40|CP021257|CRISPRCasFinder 628296-628335 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975
CP021257_1 1.9|207181|35|CP021257|CRISPRCasFinder,CRT,PILER-CR 207181-207215 35 JX094500 Cronobacter phage CR5, complete genome 89715-89749 8 0.771

1. spacer 2.1|628296|40|CP021257|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975 

aataaatttattattgcatttttttgcattaattcaccat	CRISPR spacer
aataaatttattattgcatttatttgcattaattcaccat	Protospacer
********************* ******************

2. spacer 1.9|207181|35|CP021257|CRISPRCasFinder,CRT,PILER-CR matches to JX094500 (Cronobacter phage CR5, complete genome) position: , mismatch: 8, identity: 0.771 

tcaagttgaaaatgccaaagaagccttaaaagacg	CRISPR spacer
aaaactggctaaagccaaagaagcgttaaaagacg	Protospacer
  ** * *  ** *********** **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage