Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021258 Legionella pneumophila subsp. fraseri strain D-5744 chromosome, complete genome 3 crisprs NA 0 1 0 0

Results visualization

1. CP021258
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021258_1 200541-201231 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021258_2 1742940-1743060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021258_3 2677034-2677206 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021258_3 3.2|2677136|40|CP021258|CRISPRCasFinder 2677136-2677175 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975

1. spacer 3.2|2677136|40|CP021258|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975 

atggtgaattaatgcaaaaaaatgcaataataaatttatt	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatt	Protospacer
****************** *********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage