Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021259 Legionella pneumophila strain D-7708 chromosome, complete genome 2 crisprs NA 0 1 0 0

Results visualization

1. CP021259
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021259_1 1808740-1808855 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021259_2 2697242-2697409 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021259_2 2.2|2697339|45|CP021259|CRISPRCasFinder 2697339-2697383 45 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257703 2 0.956

1. spacer 2.2|2697339|45|CP021259|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 2, identity: 0.956 

atggtgaattaatgcaaaaaaatgcaataataaatttattttaat	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatttttat	Protospacer
****************** *********************** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage