Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027222 Escherichia coli strain 2015C-3101 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP027221 Escherichia coli strain 2015C-3101 chromosome, complete genome 3 crisprs NA 0 6 0 0

Results visualization

1. CP027221
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027221_1 3999406-3999739 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027221_2 4025440-4025834 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027221_3 4142955-4143044 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027221_1 1.1|3999435|32|CP027221|CRT 3999435-3999466 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP027221_3 3.1|4142986|28|CP027221|CRISPRCasFinder 4142986-4143013 28 MN694712 Marine virus AFVG_250M502, complete genome 31102-31129 4 0.857
CP027221_3 3.1|4142986|28|CP027221|CRISPRCasFinder 4142986-4143013 28 MN694478 Marine virus AFVG_250M504, complete genome 5065-5092 4 0.857
CP027221_3 3.1|4142986|28|CP027221|CRISPRCasFinder 4142986-4143013 28 MN694270 Marine virus AFVG_250M505, complete genome 5187-5214 4 0.857
CP027221_3 3.1|4142986|28|CP027221|CRISPRCasFinder 4142986-4143013 28 MN693238 Marine virus AFVG_25M402, complete genome 24599-24626 5 0.821
CP027221_1 1.2|3999496|32|CP027221|CRT,PILER-CR,CRISPRCasFinder 3999496-3999527 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027221_1 1.1|3999435|32|CP027221|CRT 3999435-3999466 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP027221_1 1.1|3999435|32|CP027221|CRT 3999435-3999466 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP027221_2 2.1|4025469|32|CP027221|CRISPRCasFinder 4025469-4025500 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027221_1 1.1|3999435|32|CP027221|CRT 3999435-3999466 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP027221_1 1.3|3999557|32|CP027221|CRT,PILER-CR,CRISPRCasFinder 3999557-3999588 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027221_1 1.4|3999618|32|CP027221|CRT,PILER-CR,CRISPRCasFinder 3999618-3999649 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027221_1 1.4|3999618|32|CP027221|CRT,PILER-CR,CRISPRCasFinder 3999618-3999649 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|3999435|32|CP027221|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906 

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 3.1|4142986|28|CP027221|CRISPRCasFinder matches to MN694712 (Marine virus AFVG_250M502, complete genome) position: , mismatch: 4, identity: 0.857 

tacacttttt-tagagatgaaaaaggtat	CRISPR spacer
-atagtttttacagagatgaaaaaggtat	Protospacer
 *.* ***** .*****************

3. spacer 3.1|4142986|28|CP027221|CRISPRCasFinder matches to MN694478 (Marine virus AFVG_250M504, complete genome) position: , mismatch: 4, identity: 0.857 

tacacttttt-tagagatgaaaaaggtat	CRISPR spacer
-atagtttttacagagatgaaaaaggtat	Protospacer
 *.* ***** .*****************

4. spacer 3.1|4142986|28|CP027221|CRISPRCasFinder matches to MN694270 (Marine virus AFVG_250M505, complete genome) position: , mismatch: 4, identity: 0.857 

tacacttttt-tagagatgaaaaaggtat	CRISPR spacer
-atagtttttacagagatgaaaaaggtat	Protospacer
 *.* ***** .*****************

5. spacer 3.1|4142986|28|CP027221|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 5, identity: 0.821 

tacacttttttagagatgaaaaaggtat	CRISPR spacer
tagacctttttagagatgaaaaagcaaa	Protospacer
** **.******************  *

6. spacer 1.2|3999496|32|CP027221|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

7. spacer 1.1|3999435|32|CP027221|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781 

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

8. spacer 1.1|3999435|32|CP027221|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

9. spacer 2.1|4025469|32|CP027221|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

10. spacer 1.1|3999435|32|CP027221|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719 

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

11. spacer 1.3|3999557|32|CP027221|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719 

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ .

12. spacer 1.4|3999618|32|CP027221|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .**

13. spacer 1.4|3999618|32|CP027221|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage