1. spacer 4.1|3072469|40|CP027310|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975
acagcacagcggggggaatttcaagaatgacccgcagcgc CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc Protospacer
*************** ************************
2. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812
ccaccgttttcgcccaccagggcgcacaaccc- CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc Protospacer
*******.******* ******* ****.*.
3. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
ccaccgttttcgcccaccagggcgcacaaccc- CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc Protospacer
*******.****** ********. **. **.
4. spacer 3.11|2452384|31|CP027310|CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 8, identity: 0.742
gcgcaccgttgcgtcgaaaaggcgctggaga CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgt Protospacer
* ***** ******* ********* *
5. spacer 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat Protospacer
*. * ***.************* *****
6. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
7. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
8. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
9. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
10. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt Protospacer
************* *.******* * *..
11. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
12. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
13. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
14. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
15. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
16. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
17. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
18. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
19. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
20. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
21. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
22. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
23. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
24. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
25. spacer 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt Protospacer
* ..***** *****.*********** ..
26. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa Protospacer
******* ****** ********* ..