Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027323 Escherichia coli strain 2013C-3033 chromosome, complete genome 5 crisprs NA 0 10 0 0
CP027324 Escherichia coli strain 2013C-3033 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027323
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027323_1 474359-474504 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027323_2 1375875-1375998 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027323_3 2118061-2118205 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027323_4 2939059-2939636 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027323_5 2965339-2965611 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027323_2 2.1|1375918|38|CP027323|CRISPRCasFinder 1375918-1375955 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027323_4 4.1|2939088|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939088-2939119 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027323_4 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939149-2939180 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
CP027323_4 4.5|2939332|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939332-2939363 32 NC_021529 Vibrio phage nt-1, complete genome 92167-92198 7 0.781
CP027323_4 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939515-2939546 32 AP014324 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S33-C64, *** SEQUENCING IN PROGRESS *** 30389-30420 7 0.781
CP027323_4 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939149-2939180 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
CP027323_4 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939271-2939302 32 NZ_KX893538 Pseudomonas fluorescens strain PC20 plasmid pG20, complete sequence 92280-92311 8 0.75
CP027323_4 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939515-2939546 32 NZ_CP014218 Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence 43450-43481 8 0.75
CP027323_4 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939515-2939546 32 NZ_CP014173 Clostridium botulinum strain B609 plasmid pRSJ22_2, complete sequence 7656-7687 8 0.75
CP027323_5 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT 2965490-2965521 32 NZ_CP030360 Salinibacter ruber strain SP38 plasmid pSR76, complete sequence 4393-4424 8 0.75
CP027323_5 5.7|2965491|32|CP027323|PILER-CR 2965491-2965522 32 NZ_CP030360 Salinibacter ruber strain SP38 plasmid pSR76, complete sequence 4393-4424 8 0.75
CP027323_4 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939149-2939180 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
CP027323_4 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939271-2939302 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 337384-337415 9 0.719
CP027323_4 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939271-2939302 32 CP027479 Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence 189914-189945 9 0.719
CP027323_4 4.5|2939332|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939332-2939363 32 NZ_CP015355 Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence 26849-26880 9 0.719
CP027323_4 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939515-2939546 32 MN856013 Myoviridae sp. isolate 131, complete genome 19253-19284 9 0.719
CP027323_5 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT 2965490-2965521 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1739097-1739128 9 0.719
CP027323_5 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT 2965490-2965521 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1743765-1743796 9 0.719
CP027323_5 5.4|2965551|32|CP027323|CRISPRCasFinder,CRT 2965551-2965582 32 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 587304-587335 9 0.719
CP027323_5 5.7|2965491|32|CP027323|PILER-CR 2965491-2965522 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1739097-1739128 9 0.719
CP027323_5 5.7|2965491|32|CP027323|PILER-CR 2965491-2965522 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1743765-1743796 9 0.719
CP027323_5 5.8|2965552|32|CP027323|PILER-CR 2965552-2965583 32 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 587304-587335 9 0.719
CP027323_5 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT 2965490-2965521 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 809565-809596 10 0.688
CP027323_5 5.7|2965491|32|CP027323|PILER-CR 2965491-2965522 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 809565-809596 10 0.688
CP027323_4 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT 2939271-2939302 32 NZ_AP014639 Leptolyngbya boryana IAM M-101 plasmid pLBA 74288-74319 11 0.656

1. spacer 2.1|1375918|38|CP027323|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 4.1|2939088|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..**

4. spacer 4.5|2939332|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 7, identity: 0.781 

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
gtcaacataatgagcaaaatcaacgtctctgt	Protospacer
* ********.**.*************  . *

5. spacer 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to AP014324 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S33-C64, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781 

aactggat-tctgctctaattattacatcatcg	CRISPR spacer
-tttgtatatctgctctaatagttacatcatca	Protospacer
  .** ** *********** .**********.

6. spacer 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .*

7. spacer 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX893538 (Pseudomonas fluorescens strain PC20 plasmid pG20, complete sequence) position: , mismatch: 8, identity: 0.75 

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtaatcgt	Protospacer
.************** ** *****  *. **.

8. spacer 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014218 (Clostridium botulinum strain B515 plasmid pRSJ21_3, complete sequence) position: , mismatch: 8, identity: 0.75 

aactgga---ttctgctctaattattacatcatcg	CRISPR spacer
---cagatccttctgctttaattgttacatcatct	Protospacer
   ..**   *******.*****.**********

9. spacer 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014173 (Clostridium botulinum strain B609 plasmid pRSJ22_2, complete sequence) position: , mismatch: 8, identity: 0.75 

aactgga---ttctgctctaattattacatcatcg	CRISPR spacer
---cagatccttctgctttaattgttacatcatct	Protospacer
   ..**   *******.*****.**********

10. spacer 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT matches to NZ_CP030360 (Salinibacter ruber strain SP38 plasmid pSR76, complete sequence) position: , mismatch: 8, identity: 0.75 

gcccgccgccgctgtcgttcggtagtgtccgg---	CRISPR spacer
ggccgccgccactgtcgttcggaag---gcgagcc	Protospacer
* ********.*********** **    **.

11. spacer 5.7|2965491|32|CP027323|PILER-CR matches to NZ_CP030360 (Salinibacter ruber strain SP38 plasmid pSR76, complete sequence) position: , mismatch: 8, identity: 0.75 

gcccgccgccgctgtcgttcggtagtgtccgg---	CRISPR spacer
ggccgccgccactgtcgttcggaag---gcgagcc	Protospacer
* ********.*********** **    **.

12. spacer 4.2|2939149|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **

13. spacer 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt	Protospacer
.************** ** *****  .. **.

14. spacer 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to CP027479 (Pseudomonas koreensis strain P19E3 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719 

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
actggttttgaatcggccggcgctgtgatcgt	Protospacer
.************** ** *****  .. **.

15. spacer 4.5|2939332|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
tgcaacagaaccaacaaaatcaacattatatc	Protospacer
 ****** *** ************.*.*  ..

16. spacer 4.8|2939515|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to MN856013 (Myoviridae sp. isolate 131, complete genome) position: , mismatch: 9, identity: 0.719 

aactggattctgctctaattattacatcatcg	CRISPR spacer
tgccgatttctgctgtaatttttacatcattt	Protospacer
 .*.*. ******* ***** *********.

17. spacer 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
gcccgccgccgctgccgtgcggttactcgcgt	Protospacer
**************.*** **** .. . **

18. spacer 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
gcccgccgccgctgccgtgcggttactcgcgt	Protospacer
**************.*** **** .. . **

19. spacer 5.4|2965551|32|CP027323|CRISPRCasFinder,CRT matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 9, identity: 0.719 

caggcagagaatgactatttttctacaaatct	CRISPR spacer
tattttgagaatgactatttttccaaaaaagt	Protospacer
.*  . *****************.* ***  *

20. spacer 5.7|2965491|32|CP027323|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
gcccgccgccgctgccgtgcggttactcgcgt	Protospacer
**************.*** **** .. . **

21. spacer 5.7|2965491|32|CP027323|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
gcccgccgccgctgccgtgcggttactcgcgt	Protospacer
**************.*** **** .. . **

22. spacer 5.8|2965552|32|CP027323|PILER-CR matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 9, identity: 0.719 

caggcagagaatgactatttttctacaaatct	CRISPR spacer
tattttgagaatgactatttttccaaaaaagt	Protospacer
.*  . *****************.* ***  *

23. spacer 5.3|2965490|32|CP027323|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
tgccgccgccgctgtggttcggcagcgcgttt	Protospacer
  ************* ******.**.*. .

24. spacer 5.7|2965491|32|CP027323|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688 

gcccgccgccgctgtcgttcggtagtgtccgg	CRISPR spacer
tgccgccgccgctgtggttcggcagcgcgttt	Protospacer
  ************* ******.**.*. .

25. spacer 4.4|2939271|32|CP027323|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014639 (Leptolyngbya boryana IAM M-101 plasmid pLBA) position: , mismatch: 11, identity: 0.656 

gctggttttgaatcgtcccgcgctcgagacgc	CRISPR spacer
caatgttttgactcgccccgcgctcgaagaag	Protospacer
    ******* ***.***********.. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage