Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP027325 Escherichia coli strain 2013C-4830 chromosome, complete genome 7 crisprs NA 0 3 0 0
CP027326 Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027325
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_1 398233-398353 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_2 1693004-1693116 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_3 1951310-1951425 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_4 2820980-2821128 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_5 3041918-3042009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_6 5089278-5089368 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027325_7 5114497-5114580 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027325_3 3.1|1951341|54|CP027325|CRISPRCasFinder 1951341-1951394 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027325_5 5.1|3041944|40|CP027325|CRISPRCasFinder 3041944-3041983 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 11 0.807
CP027325_3 3.1|1951341|54|CP027325|CRISPRCasFinder 1951341-1951394 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12104-12160 13 0.772
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3364-3420 16 0.719
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3363-3419 16 0.719
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3363-3419 16 0.719
CP027325_2 2.1|1693032|57|CP027325|CRISPRCasFinder 1693032-1693088 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3363-3419 16 0.719

1. spacer 3.1|1951341|54|CP027325|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 5.1|3041944|40|CP027325|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

3. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.807 

-acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagttca	CRISPR spacer
aacaattacca-ggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccg	Protospacer
 ***** ** . . **************** ************* *********..*.

4. spacer 3.1|1951341|54|CP027325|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****

5. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.772 

-----acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
ctccgacgtt-----cggtgcctgatgcgacgctggcgcgtcttatcaggcctacgagtc	Protospacer
     **. *     *. **************** ************************.

6. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

7. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

8. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

9. spacer 2.1|1693032|57|CP027325|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage