1. spacer 1.1|2853840|32|CP027338|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc Protospacer
.*******.*********************.*
2. spacer 1.2|2853901|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
aaaaccaaacttctccataaattccatagccg CRISPR spacer
attactaaacttctgcataaattccataggag Protospacer
* **.******** ************** *
3. spacer 1.1|2853840|32|CP027338|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781
taagtgat-atccatcatcgcatccagtgcgcc CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc Protospacer
.. **** .*** ******** **********
4. spacer 1.1|2853840|32|CP027338|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
taagtg---atatccatcatcgcatccagtgcgcc CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc Protospacer
*** . *******.*** ***********
5. spacer 1.5|2854084|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75
tcttcgcgggtaatcaatgatgattcagtttc CRISPR spacer
tcttcgcggataatcaaagatgatcgtgaatt Protospacer
*********.******* ******. * *.
6. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat Protospacer
. *.******* *** ***********...**
7. spacer 1.1|2853840|32|CP027338|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc Protospacer
. .* ..*********** ***********
8. spacer 1.3|2853962|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
gagagtgctgacaggtgtctcgattacctgat CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg Protospacer
*. *****.***** ************ .
9. spacer 1.6|2854145|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgcaatatcacggcgttctgcggcctcgg CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc Protospacer
. ****************.* **** .**
10. spacer 1.6|2854145|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgcaatatcacggcgttctgcggcctcgg CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc Protospacer
. ****.************* **** .**
11. spacer 2.2|2880117|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcatagccaggctgatccggcgacggcctta CRISPR spacer
gcagcagaccggctgatccggcgacggccccg Protospacer
* ..** * *******************...
12. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
13. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
14. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
15. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
16. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
17. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
18. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
19. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
20. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
21. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
22. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
23. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
24. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
25. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
26. spacer 2.7|2880422|32|CP027338|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
27. spacer 1.5|2854084|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688
tcttcgcgggtaatcaatgatgattcagtttc CRISPR spacer
cagttgcaggtaatcaatgatgatgcagccca Protospacer
. *.**.**************** ***...
28. spacer 1.7|2854206|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc Protospacer
. ..**.*************** **** .*
29. spacer 1.7|2854206|32|CP027338|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg Protospacer
. ..**.*************** **** .
30. spacer 2.9|2880116|34|CP027338|PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
tcggcatagccaggctgatccggcgacggcctta CRISPR spacer
gagcagcagaccggctgatccggcgacggccccg Protospacer
* ..** * *******************...
