Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027341 Escherichia coli strain 2015C-3121 plasmid unnamed 0 crisprs NA 0 0 0 0
CP027340 Escherichia coli strain 2015C-3121 chromosome, complete genome 3 crisprs NA 0 5 0 0

Results visualization

1. CP027340
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027340_1 73476-74116 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027340_2 99769-99982 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027340_3 2998985-2999130 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027340_1 1.1|73505|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73505-73536 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027340_1 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73566-73597 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
CP027340_1 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73811-73842 32 NZ_CP015609 Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence 10946-10977 6 0.812
CP027340_1 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73811-73842 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 305380-305411 6 0.812
CP027340_2 2.5|99861|32|CP027340|CRISPRCasFinder 99861-99892 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027340_1 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73566-73597 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
CP027340_2 2.2|99861|30|CP027340|PILER-CR,CRT 99861-99890 30 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68187 8 0.733
CP027340_1 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73566-73597 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
CP027340_1 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT 73811-73842 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 74068-74099 10 0.688

1. spacer 1.1|73505|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

2. spacer 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..**

3. spacer 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015609 (Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
ggattggtcaggccgggaagcgcggttgccgc	Protospacer
* * **** *******************   *

4. spacer 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
ggattggtcaggccgggaagcgcggttgccgc	Protospacer
* * **** *******************   *

5. spacer 2.5|99861|32|CP027340|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

gtgaccgtcggtgttacgctgaactgctgaaa--	CRISPR spacer
gtgaccgtcggtgttccggtgaa--gcggaaggc	Protospacer
*************** ** ****  ** ***.

6. spacer 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .*

7. spacer 2.2|99861|30|CP027340|PILER-CR,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

gtgaccgtcggtgttacgctgaactgctga	CRISPR spacer
gtgaccgtcggtgttccggtgaagcggaag	Protospacer
*************** ** **** .*  ..

8. spacer 1.2|73566|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **

9. spacer 1.6|73811|32|CP027340|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 10, identity: 0.688 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
tgcgtggtgcgcccgggaagcgcggtgtcgca	Protospacer
   ****** * **************   *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage